Incidental Mutation 'R5525:Zfp322a'
ID431823
Institutional Source Beutler Lab
Gene Symbol Zfp322a
Ensembl Gene ENSMUSG00000046351
Gene Namezinc finger protein 322A
Synonyms
MMRRC Submission 043083-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.108) question?
Stock #R5525 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location23353103-23369208 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 23357515 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 19 (V19A)
Ref Sequence ENSEMBL: ENSMUSP00000119883 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050101] [ENSMUST00000125328] [ENSMUST00000145451] [ENSMUST00000152557]
Predicted Effect unknown
Transcript: ENSMUST00000050101
AA Change: V19A
SMART Domains Protein: ENSMUSP00000061524
Gene: ENSMUSG00000046351
AA Change: V19A

DomainStartEndE-ValueType
ZnF_C2H2 81 103 6.42e-4 SMART
ZnF_C2H2 109 131 3.34e-2 SMART
ZnF_C2H2 137 159 1.28e-3 SMART
ZnF_C2H2 165 187 2.95e-3 SMART
ZnF_C2H2 193 215 1.95e-3 SMART
ZnF_C2H2 221 243 4.79e-3 SMART
ZnF_C2H2 249 271 5.14e-3 SMART
ZnF_C2H2 277 299 8.94e-3 SMART
ZnF_C2H2 303 325 5.68e1 SMART
ZnF_C2H2 361 383 1.89e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122940
Predicted Effect unknown
Transcript: ENSMUST00000125328
AA Change: V19A
SMART Domains Protein: ENSMUSP00000120804
Gene: ENSMUSG00000046351
AA Change: V19A

DomainStartEndE-ValueType
ZnF_C2H2 81 103 6.42e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000145451
AA Change: V19A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000119883
Gene: ENSMUSG00000046351
AA Change: V19A

DomainStartEndE-ValueType
ZnF_C2H2 81 103 6.42e-4 SMART
ZnF_C2H2 109 131 3.34e-2 SMART
ZnF_C2H2 137 159 1.28e-3 SMART
Predicted Effect unknown
Transcript: ENSMUST00000152557
AA Change: V19A
SMART Domains Protein: ENSMUSP00000118754
Gene: ENSMUSG00000046351
AA Change: V19A

DomainStartEndE-ValueType
ZnF_C2H2 81 103 6.42e-4 SMART
ZnF_C2H2 109 131 3.34e-2 SMART
ZnF_C2H2 137 159 1.28e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223795
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224779
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.3%
  • 10x: 95.2%
  • 20x: 90.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] ZNF322A is a member of the zinc-finger transcription factor family and may regulate transcriptional activation in MAPK (see MAPK1; MIM 176948) signaling pathways (Li et al., 2004 [PubMed 15555580]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acan A G 7: 79,099,983 T1501A probably benign Het
Acin1 G A 14: 54,664,391 A648V possibly damaging Het
Agap1 A G 1: 89,743,773 T401A possibly damaging Het
Anapc4 T G 5: 52,856,809 M440R probably damaging Het
Ankrd26 A G 6: 118,527,731 M739T probably benign Het
Brip1 T C 11: 86,110,447 E721G possibly damaging Het
Bzw1 A G 1: 58,402,906 E221G possibly damaging Het
Cenpm A C 15: 82,239,291 probably null Het
Exosc1 T A 19: 41,924,018 K143N probably damaging Het
Fgd5 T A 6: 92,066,247 L1236Q probably damaging Het
Gemin6 T G 17: 80,227,749 V46G probably damaging Het
Grm3 C T 5: 9,504,872 V807I probably damaging Het
Kndc1 A G 7: 139,924,111 N1110S probably benign Het
Magi1 A T 6: 93,792,373 V17D possibly damaging Het
Mdn1 T G 4: 32,767,961 M5298R possibly damaging Het
Nlrp9c T A 7: 26,384,501 E551V probably damaging Het
Oacyl A C 18: 65,745,356 I457L probably benign Het
Olfr103 C T 17: 37,336,626 G202D probably damaging Het
Olfr1102 A T 2: 87,002,339 E123D possibly damaging Het
Olfr494 A G 7: 108,367,999 I170V probably benign Het
Rab11fip3 T C 17: 25,991,295 E996G probably damaging Het
Rabep1 T A 11: 70,923,146 S554T probably damaging Het
Rln1 T C 19: 29,334,520 E26G probably benign Het
Rpf1 A G 3: 146,517,804 silent Het
Sdk1 T C 5: 142,185,265 V1961A possibly damaging Het
Serpinb8 A T 1: 107,607,293 I365F probably damaging Het
Shank2 A G 7: 144,070,109 D277G probably damaging Het
Snapc4 ACTGCTGCTGCTGCTGCTGC ACTGCTGCTGCTGCTGC 2: 26,369,526 probably benign Het
Thsd7a T C 6: 12,332,007 T1269A possibly damaging Het
Ttll3 A G 6: 113,412,978 N776D probably benign Het
Unc80 A G 1: 66,606,614 E1483G possibly damaging Het
Ush2a A G 1: 188,753,606 D2971G probably benign Het
Zfp462 C A 4: 55,050,281 P2164T possibly damaging Het
Other mutations in Zfp322a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02579:Zfp322a APN 13 23357443 missense probably damaging 0.97
R1395:Zfp322a UTSW 13 23356775 missense probably benign 0.01
R1975:Zfp322a UTSW 13 23356904 missense probably damaging 1.00
R2100:Zfp322a UTSW 13 23357290 missense possibly damaging 0.85
R2332:Zfp322a UTSW 13 23357324 missense probably damaging 1.00
R2571:Zfp322a UTSW 13 23356444 missense probably damaging 1.00
R4959:Zfp322a UTSW 13 23356882 missense probably damaging 1.00
R5245:Zfp322a UTSW 13 23356986 nonsense probably null
R5310:Zfp322a UTSW 13 23357362 missense possibly damaging 0.90
R5389:Zfp322a UTSW 13 23356979 missense probably damaging 1.00
R5810:Zfp322a UTSW 13 23357409 nonsense probably null
R7299:Zfp322a UTSW 13 23357143 missense probably damaging 0.97
R7299:Zfp322a UTSW 13 23357144 missense probably benign 0.22
R7301:Zfp322a UTSW 13 23357143 missense probably damaging 0.97
R7301:Zfp322a UTSW 13 23357144 missense probably benign 0.22
Predicted Primers PCR Primer
(F):5'- AAGATCTGATTTCCCACTAAAAGC -3'
(R):5'- GTCTCATAGGTTTGGAGGTACC -3'

Sequencing Primer
(F):5'- AGTGGTGCCAAAAGCTCTTC -3'
(R):5'- TGGAGGTACCAAGTAAGAAACTAATG -3'
Posted On2016-10-05