Incidental Mutation 'R5525:Acin1'
ID 431824
Institutional Source Beutler Lab
Gene Symbol Acin1
Ensembl Gene ENSMUSG00000022185
Gene Name apoptotic chromatin condensation inducer 1
Synonyms 2610036I19Rik, 2610510L13Rik, Acinus
MMRRC Submission 043083-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.940) question?
Stock # R5525 (G1)
Quality Score 225
Status Not validated
Chromosome 14
Chromosomal Location 54879618-54924388 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 54901848 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Alanine to Valine at position 648 (A648V)
Ref Sequence ENSEMBL: ENSMUSP00000022793 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022793] [ENSMUST00000111484] [ENSMUST00000125265]
AlphaFold Q9JIX8
Predicted Effect possibly damaging
Transcript: ENSMUST00000022793
AA Change: A648V

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000022793
Gene: ENSMUSG00000022185
AA Change: A648V

DomainStartEndE-ValueType
SAP 72 106 1.29e-8 SMART
coiled coil region 138 175 N/A INTRINSIC
low complexity region 205 220 N/A INTRINSIC
coiled coil region 259 300 N/A INTRINSIC
low complexity region 378 396 N/A INTRINSIC
low complexity region 414 423 N/A INTRINSIC
low complexity region 573 603 N/A INTRINSIC
low complexity region 631 662 N/A INTRINSIC
low complexity region 734 743 N/A INTRINSIC
low complexity region 760 773 N/A INTRINSIC
low complexity region 778 792 N/A INTRINSIC
low complexity region 803 813 N/A INTRINSIC
internal_repeat_1 817 892 1.63e-6 PROSPERO
low complexity region 927 952 N/A INTRINSIC
RRM 1012 1081 8.3e-2 SMART
Pfam:RSB_motif 1139 1246 5.7e-30 PFAM
low complexity region 1275 1329 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000111484
AA Change: A608V

PolyPhen 2 Score 0.940 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000107109
Gene: ENSMUSG00000022185
AA Change: A608V

DomainStartEndE-ValueType
SAP 72 106 1.29e-8 SMART
coiled coil region 138 172 N/A INTRINSIC
coiled coil region 219 260 N/A INTRINSIC
low complexity region 338 356 N/A INTRINSIC
low complexity region 374 383 N/A INTRINSIC
low complexity region 533 563 N/A INTRINSIC
low complexity region 591 622 N/A INTRINSIC
low complexity region 694 703 N/A INTRINSIC
low complexity region 720 733 N/A INTRINSIC
low complexity region 738 752 N/A INTRINSIC
low complexity region 763 773 N/A INTRINSIC
internal_repeat_1 777 852 1.21e-6 PROSPERO
low complexity region 887 912 N/A INTRINSIC
RRM 972 1041 8.3e-2 SMART
low complexity region 1073 1123 N/A INTRINSIC
low complexity region 1130 1168 N/A INTRINSIC
coiled coil region 1188 1253 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000125265
SMART Domains Protein: ENSMUSP00000120445
Gene: ENSMUSG00000022185

DomainStartEndE-ValueType
Blast:BRLZ 1 27 3e-9 BLAST
coiled coil region 32 66 N/A INTRINSIC
coiled coil region 113 154 N/A INTRINSIC
low complexity region 232 250 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129700
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141993
Predicted Effect unknown
Transcript: ENSMUST00000147714
AA Change: A593V
SMART Domains Protein: ENSMUSP00000119080
Gene: ENSMUSG00000022185
AA Change: A593V

DomainStartEndE-ValueType
SAP 18 52 1.29e-8 SMART
coiled coil region 83 120 N/A INTRINSIC
low complexity region 151 166 N/A INTRINSIC
coiled coil region 204 245 N/A INTRINSIC
low complexity region 324 342 N/A INTRINSIC
low complexity region 360 369 N/A INTRINSIC
low complexity region 519 549 N/A INTRINSIC
low complexity region 577 608 N/A INTRINSIC
low complexity region 680 689 N/A INTRINSIC
low complexity region 706 719 N/A INTRINSIC
low complexity region 724 738 N/A INTRINSIC
low complexity region 749 759 N/A INTRINSIC
low complexity region 861 886 N/A INTRINSIC
RRM 946 1015 8.3e-2 SMART
Pfam:RSB_motif 1065 1180 1.1e-29 PFAM
low complexity region 1209 1263 N/A INTRINSIC
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.3%
  • 10x: 95.2%
  • 20x: 90.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Apoptosis is defined by several morphologic nuclear changes, including chromatin condensation and nuclear fragmentation. This gene encodes a nuclear protein that induces apoptotic chromatin condensation after activation by caspase-3, without inducing DNA fragmentation. This protein has also been shown to be a component of a splicing-dependent multiprotein exon junction complex (EJC) that is deposited at splice junctions on mRNAs, as a consequence of pre-mRNA splicing. It may thus be involved in mRNA metabolism associated with splicing. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Oct 2011]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acan A G 7: 78,749,731 (GRCm39) T1501A probably benign Het
Agap1 A G 1: 89,671,495 (GRCm39) T401A possibly damaging Het
Anapc4 T G 5: 53,014,151 (GRCm39) M440R probably damaging Het
Ankrd26 A G 6: 118,504,692 (GRCm39) M739T probably benign Het
Brip1 T C 11: 86,001,273 (GRCm39) E721G possibly damaging Het
Bzw1 A G 1: 58,442,065 (GRCm39) E221G possibly damaging Het
Cenpm A C 15: 82,123,492 (GRCm39) probably null Het
Exosc1 T A 19: 41,912,457 (GRCm39) K143N probably damaging Het
Fgd5 T A 6: 92,043,228 (GRCm39) L1236Q probably damaging Het
Gemin6 T G 17: 80,535,178 (GRCm39) V46G probably damaging Het
Grm3 C T 5: 9,554,872 (GRCm39) V807I probably damaging Het
Kndc1 A G 7: 139,504,026 (GRCm39) N1110S probably benign Het
Magi1 A T 6: 93,769,354 (GRCm39) V17D possibly damaging Het
Mdn1 T G 4: 32,767,961 (GRCm39) M5298R possibly damaging Het
Nlrp9c T A 7: 26,083,926 (GRCm39) E551V probably damaging Het
Oacyl A C 18: 65,878,427 (GRCm39) I457L probably benign Het
Or12d13 C T 17: 37,647,517 (GRCm39) G202D probably damaging Het
Or5p69 A G 7: 107,967,206 (GRCm39) I170V probably benign Het
Or5t17 A T 2: 86,832,683 (GRCm39) E123D possibly damaging Het
Rab11fip3 T C 17: 26,210,269 (GRCm39) E996G probably damaging Het
Rabep1 T A 11: 70,813,972 (GRCm39) S554T probably damaging Het
Rln1 T C 19: 29,311,920 (GRCm39) E26G probably benign Het
Rpf1 A G 3: 146,223,559 (GRCm39) silent Het
Sdk1 T C 5: 142,171,020 (GRCm39) V1961A possibly damaging Het
Serpinb8 A T 1: 107,535,023 (GRCm39) I365F probably damaging Het
Shank2 A G 7: 143,623,846 (GRCm39) D277G probably damaging Het
Snapc4 ACTGCTGCTGCTGCTGCTGC ACTGCTGCTGCTGCTGC 2: 26,259,538 (GRCm39) probably benign Het
Thsd7a T C 6: 12,332,006 (GRCm39) T1269A possibly damaging Het
Ttll3 A G 6: 113,389,939 (GRCm39) N776D probably benign Het
Unc80 A G 1: 66,645,773 (GRCm39) E1483G possibly damaging Het
Ush2a A G 1: 188,485,803 (GRCm39) D2971G probably benign Het
Zfp322a A G 13: 23,541,685 (GRCm39) V19A probably benign Het
Zfp462 C A 4: 55,050,281 (GRCm39) P2164T possibly damaging Het
Other mutations in Acin1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00988:Acin1 APN 14 54,884,257 (GRCm39) missense probably damaging 1.00
IGL01530:Acin1 APN 14 54,881,443 (GRCm39) missense probably damaging 1.00
IGL02396:Acin1 APN 14 54,882,256 (GRCm39) intron probably benign
IGL02967:Acin1 APN 14 54,880,210 (GRCm39) missense possibly damaging 0.80
Protuberant UTSW 14 54,882,740 (GRCm39) missense probably damaging 1.00
R0411:Acin1 UTSW 14 54,884,231 (GRCm39) missense probably damaging 1.00
R0723:Acin1 UTSW 14 54,902,908 (GRCm39) missense probably damaging 0.98
R0755:Acin1 UTSW 14 54,889,292 (GRCm39) start codon destroyed probably null 0.93
R0784:Acin1 UTSW 14 54,890,985 (GRCm39) unclassified probably benign
R1600:Acin1 UTSW 14 54,881,174 (GRCm39) intron probably benign
R1682:Acin1 UTSW 14 54,901,175 (GRCm39) missense probably damaging 1.00
R1721:Acin1 UTSW 14 54,901,995 (GRCm39) missense probably benign 0.01
R1756:Acin1 UTSW 14 54,902,661 (GRCm39) missense probably benign 0.30
R1867:Acin1 UTSW 14 54,881,718 (GRCm39) missense probably damaging 1.00
R1997:Acin1 UTSW 14 54,884,156 (GRCm39) splice site probably null
R2067:Acin1 UTSW 14 54,902,711 (GRCm39) missense probably damaging 1.00
R3947:Acin1 UTSW 14 54,916,790 (GRCm39) missense possibly damaging 0.89
R4374:Acin1 UTSW 14 54,891,351 (GRCm39) unclassified probably benign
R4476:Acin1 UTSW 14 54,882,787 (GRCm39) missense probably damaging 1.00
R4501:Acin1 UTSW 14 54,924,044 (GRCm39) missense probably damaging 1.00
R4547:Acin1 UTSW 14 54,883,124 (GRCm39) missense probably benign 0.01
R4621:Acin1 UTSW 14 54,890,900 (GRCm39) unclassified probably benign
R4657:Acin1 UTSW 14 54,880,504 (GRCm39) missense possibly damaging 0.93
R4680:Acin1 UTSW 14 54,924,215 (GRCm39) missense probably benign 0.00
R4696:Acin1 UTSW 14 54,880,474 (GRCm39) intron probably benign
R4806:Acin1 UTSW 14 54,916,685 (GRCm39) splice site probably benign
R4826:Acin1 UTSW 14 54,902,074 (GRCm39) missense probably damaging 0.97
R5096:Acin1 UTSW 14 54,916,679 (GRCm39) intron probably benign
R5153:Acin1 UTSW 14 54,883,070 (GRCm39) missense probably benign 0.25
R5223:Acin1 UTSW 14 54,880,398 (GRCm39) frame shift probably null
R5260:Acin1 UTSW 14 54,880,279 (GRCm39) intron probably benign
R5575:Acin1 UTSW 14 54,916,195 (GRCm39) splice site probably null
R5902:Acin1 UTSW 14 54,901,130 (GRCm39) missense probably benign 0.01
R6211:Acin1 UTSW 14 54,881,503 (GRCm39) missense probably damaging 1.00
R6524:Acin1 UTSW 14 54,882,740 (GRCm39) missense probably damaging 1.00
R6560:Acin1 UTSW 14 54,916,290 (GRCm39) missense probably benign 0.24
R6916:Acin1 UTSW 14 54,902,873 (GRCm39) missense probably benign 0.27
R7201:Acin1 UTSW 14 54,902,356 (GRCm39) missense possibly damaging 0.83
R7833:Acin1 UTSW 14 54,902,059 (GRCm39) missense possibly damaging 0.83
R8096:Acin1 UTSW 14 54,882,726 (GRCm39) missense possibly damaging 0.80
R8167:Acin1 UTSW 14 54,902,337 (GRCm39) missense probably benign 0.01
R8421:Acin1 UTSW 14 54,880,486 (GRCm39) missense unknown
R8771:Acin1 UTSW 14 54,880,496 (GRCm39) missense unknown
R8862:Acin1 UTSW 14 54,901,172 (GRCm39) missense probably benign 0.00
R9645:Acin1 UTSW 14 54,901,913 (GRCm39) missense probably benign 0.16
R9755:Acin1 UTSW 14 54,889,292 (GRCm39) missense probably damaging 0.99
X0021:Acin1 UTSW 14 54,904,558 (GRCm39) missense probably damaging 1.00
Z1177:Acin1 UTSW 14 54,880,207 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- TTGCAATCAAAGGGGTTCAGAAC -3'
(R):5'- ACTCATCCTCTAGCAGGTCC -3'

Sequencing Primer
(F):5'- TTCAGAACGGGCAGGGACC -3'
(R):5'- AGCTCTCCATCCAGATCTCCATC -3'
Posted On 2016-10-05