Incidental Mutation 'R5525:Cenpm'
ID431825
Institutional Source Beutler Lab
Gene Symbol Cenpm
Ensembl Gene ENSMUSG00000068101
Gene Namecentromere protein M
Synonyms
MMRRC Submission 043083-MU
Accession Numbers
Is this an essential gene? Not available question?
Stock #R5525 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location82233779-82244748 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to C at 82239291 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000155788 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089155] [ENSMUST00000089157] [ENSMUST00000229747] [ENSMUST00000230408]
Predicted Effect probably benign
Transcript: ENSMUST00000089155
SMART Domains Protein: ENSMUSP00000086558
Gene: ENSMUSG00000068101

DomainStartEndE-ValueType
Pfam:CENP-M 1 118 1.7e-56 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000089157
SMART Domains Protein: ENSMUSP00000086560
Gene: ENSMUSG00000068101

DomainStartEndE-ValueType
Pfam:CENP-M 1 172 1.1e-83 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229041
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229505
Predicted Effect probably benign
Transcript: ENSMUST00000229747
Predicted Effect probably null
Transcript: ENSMUST00000230408
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.3%
  • 10x: 95.2%
  • 20x: 90.9%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a protein that is present in the nucleus of actively growing cells but is excluded from the nucleus during cell division or during growth arrest as a result of contact inhibition. In human, this protein is a component of the CENP-A nucleosome-associated complex that regulates kinetochore protein assembly, mitotic cell-cycle progression, and chromosome segregation. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acan A G 7: 79,099,983 T1501A probably benign Het
Acin1 G A 14: 54,664,391 A648V possibly damaging Het
Agap1 A G 1: 89,743,773 T401A possibly damaging Het
Anapc4 T G 5: 52,856,809 M440R probably damaging Het
Ankrd26 A G 6: 118,527,731 M739T probably benign Het
Brip1 T C 11: 86,110,447 E721G possibly damaging Het
Bzw1 A G 1: 58,402,906 E221G possibly damaging Het
Exosc1 T A 19: 41,924,018 K143N probably damaging Het
Fgd5 T A 6: 92,066,247 L1236Q probably damaging Het
Gemin6 T G 17: 80,227,749 V46G probably damaging Het
Grm3 C T 5: 9,504,872 V807I probably damaging Het
Kndc1 A G 7: 139,924,111 N1110S probably benign Het
Magi1 A T 6: 93,792,373 V17D possibly damaging Het
Mdn1 T G 4: 32,767,961 M5298R possibly damaging Het
Nlrp9c T A 7: 26,384,501 E551V probably damaging Het
Oacyl A C 18: 65,745,356 I457L probably benign Het
Olfr103 C T 17: 37,336,626 G202D probably damaging Het
Olfr1102 A T 2: 87,002,339 E123D possibly damaging Het
Olfr494 A G 7: 108,367,999 I170V probably benign Het
Rab11fip3 T C 17: 25,991,295 E996G probably damaging Het
Rabep1 T A 11: 70,923,146 S554T probably damaging Het
Rln1 T C 19: 29,334,520 E26G probably benign Het
Rpf1 A G 3: 146,517,804 silent Het
Sdk1 T C 5: 142,185,265 V1961A possibly damaging Het
Serpinb8 A T 1: 107,607,293 I365F probably damaging Het
Shank2 A G 7: 144,070,109 D277G probably damaging Het
Snapc4 ACTGCTGCTGCTGCTGCTGC ACTGCTGCTGCTGCTGC 2: 26,369,526 probably benign Het
Thsd7a T C 6: 12,332,007 T1269A possibly damaging Het
Ttll3 A G 6: 113,412,978 N776D probably benign Het
Unc80 A G 1: 66,606,614 E1483G possibly damaging Het
Ush2a A G 1: 188,753,606 D2971G probably benign Het
Zfp322a A G 13: 23,357,515 V19A probably benign Het
Zfp462 C A 4: 55,050,281 P2164T possibly damaging Het
Other mutations in Cenpm
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03189:Cenpm APN 15 82234433 missense possibly damaging 0.57
R0801:Cenpm UTSW 15 82234466 missense probably benign 0.36
R1842:Cenpm UTSW 15 82239364 missense probably benign 0.02
R1878:Cenpm UTSW 15 82234415 missense probably benign 0.00
R3961:Cenpm UTSW 15 82234373 missense possibly damaging 0.94
R5409:Cenpm UTSW 15 82234363 missense probably benign
R7548:Cenpm UTSW 15 82244679 start codon destroyed probably null 1.00
R7562:Cenpm UTSW 15 82241361 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CACAAGACTTGAGCTAAGCCTC -3'
(R):5'- GCAGAGAGGTTCTCCTTACC -3'

Sequencing Primer
(F):5'- GACTTGAGCTAAGCCTCAAATC -3'
(R):5'- AGTGCTATTAACTGCTGAGCC -3'
Posted On2016-10-05