Incidental Mutation 'R5525:Olfr103'
ID431828
Institutional Source Beutler Lab
Gene Symbol Olfr103
Ensembl Gene ENSMUSG00000049618
Gene Nameolfactory receptor 103
SynonymsMOR250-3, GA_x6K02T2PSCP-1798423-1797482, MOR250-8_p
MMRRC Submission 043083-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R5525 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location37334303-37339698 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 37336626 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 202 (G202D)
Ref Sequence ENSEMBL: ENSMUSP00000134539 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058826] [ENSMUST00000173472]
Predicted Effect probably damaging
Transcript: ENSMUST00000058826
AA Change: G202D

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000094934
Gene: ENSMUSG00000049618
AA Change: G202D

DomainStartEndE-ValueType
Pfam:7tm_4 29 307 3.5e-52 PFAM
Pfam:7tm_1 39 289 3.8e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000173472
AA Change: G202D

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000134539
Gene: ENSMUSG00000049618
AA Change: G202D

DomainStartEndE-ValueType
Pfam:7tm_1 39 289 2.8e-31 PFAM
Pfam:7tm_4 137 282 1.1e-38 PFAM
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.3%
  • 10x: 95.2%
  • 20x: 90.9%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acan A G 7: 79,099,983 T1501A probably benign Het
Acin1 G A 14: 54,664,391 A648V possibly damaging Het
Agap1 A G 1: 89,743,773 T401A possibly damaging Het
Anapc4 T G 5: 52,856,809 M440R probably damaging Het
Ankrd26 A G 6: 118,527,731 M739T probably benign Het
Brip1 T C 11: 86,110,447 E721G possibly damaging Het
Bzw1 A G 1: 58,402,906 E221G possibly damaging Het
Cenpm A C 15: 82,239,291 probably null Het
Exosc1 T A 19: 41,924,018 K143N probably damaging Het
Fgd5 T A 6: 92,066,247 L1236Q probably damaging Het
Gemin6 T G 17: 80,227,749 V46G probably damaging Het
Grm3 C T 5: 9,504,872 V807I probably damaging Het
Kndc1 A G 7: 139,924,111 N1110S probably benign Het
Magi1 A T 6: 93,792,373 V17D possibly damaging Het
Mdn1 T G 4: 32,767,961 M5298R possibly damaging Het
Nlrp9c T A 7: 26,384,501 E551V probably damaging Het
Oacyl A C 18: 65,745,356 I457L probably benign Het
Olfr1102 A T 2: 87,002,339 E123D possibly damaging Het
Olfr494 A G 7: 108,367,999 I170V probably benign Het
Rab11fip3 T C 17: 25,991,295 E996G probably damaging Het
Rabep1 T A 11: 70,923,146 S554T probably damaging Het
Rln1 T C 19: 29,334,520 E26G probably benign Het
Rpf1 A G 3: 146,517,804 silent Het
Sdk1 T C 5: 142,185,265 V1961A possibly damaging Het
Serpinb8 A T 1: 107,607,293 I365F probably damaging Het
Shank2 A G 7: 144,070,109 D277G probably damaging Het
Snapc4 ACTGCTGCTGCTGCTGCTGC ACTGCTGCTGCTGCTGC 2: 26,369,526 probably benign Het
Thsd7a T C 6: 12,332,007 T1269A possibly damaging Het
Ttll3 A G 6: 113,412,978 N776D probably benign Het
Unc80 A G 1: 66,606,614 E1483G possibly damaging Het
Ush2a A G 1: 188,753,606 D2971G probably benign Het
Zfp322a A G 13: 23,357,515 V19A probably benign Het
Zfp462 C A 4: 55,050,281 P2164T possibly damaging Het
Other mutations in Olfr103
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00333:Olfr103 APN 17 37336583 nonsense probably null
IGL01953:Olfr103 APN 17 37336875 missense probably damaging 1.00
IGL02556:Olfr103 APN 17 37336996 missense probably benign 0.00
IGL02574:Olfr103 APN 17 37336524 missense probably damaging 1.00
IGL02737:Olfr103 APN 17 37336773 missense possibly damaging 0.94
IGL02995:Olfr103 APN 17 37336709 missense probably damaging 1.00
R1078:Olfr103 UTSW 17 37337026 missense probably damaging 0.98
R1466:Olfr103 UTSW 17 37336956 missense probably benign 0.43
R1466:Olfr103 UTSW 17 37336956 missense probably benign 0.43
R3024:Olfr103 UTSW 17 37337027 missense probably damaging 1.00
R3858:Olfr103 UTSW 17 37337226 nonsense probably null
R4979:Olfr103 UTSW 17 37336868 missense probably benign 0.06
R5062:Olfr103 UTSW 17 37336931 missense probably damaging 0.99
R5215:Olfr103 UTSW 17 37336813 missense probably benign 0.00
R5441:Olfr103 UTSW 17 37336268 unclassified probably null
R5453:Olfr103 UTSW 17 37337062 missense possibly damaging 0.96
R5660:Olfr103 UTSW 17 37336644 missense probably damaging 1.00
R5859:Olfr103 UTSW 17 37336369 missense possibly damaging 0.61
R6211:Olfr103 UTSW 17 37336708 missense possibly damaging 0.90
R6958:Olfr103 UTSW 17 37336417 missense probably benign
R7060:Olfr103 UTSW 17 37336461 missense probably benign 0.02
R7567:Olfr103 UTSW 17 37337171 missense probably benign 0.00
R7784:Olfr103 UTSW 17 37336578 missense probably benign 0.13
R7784:Olfr103 UTSW 17 37337055 missense probably damaging 0.99
R7978:Olfr103 UTSW 17 37336501 missense probably benign 0.00
R8284:Olfr103 UTSW 17 37336696 missense probably benign 0.01
Z1088:Olfr103 UTSW 17 37336705 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ATGGCAATGATTCTGTCCTGG -3'
(R):5'- ATGGCTGTGACCATCTGGAC -3'

Sequencing Primer
(F):5'- CTGGTCTAAAGAGCTGCCTGAG -3'
(R):5'- GCTGTGACCATCTGGACCATTG -3'
Posted On2016-10-05