Incidental Mutation 'R5525:Gemin6'
Institutional Source Beutler Lab
Gene Symbol Gemin6
Ensembl Gene ENSMUSG00000055760
Gene Namegem nuclear organelle associated protein 6
MMRRC Submission 043083-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.827) question?
Stock #R5525 (G1)
Quality Score225
Status Not validated
Chromosomal Location80224441-80228497 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 80227749 bp
Amino Acid Change Valine to Glycine at position 46 (V46G)
Ref Sequence ENSEMBL: ENSMUSP00000063554 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069486]
Predicted Effect probably damaging
Transcript: ENSMUST00000069486
AA Change: V46G

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000063554
Gene: ENSMUSG00000055760
AA Change: V46G

Pfam:Gemin6 1 166 9.7e-102 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156869
Meta Mutation Damage Score 0.4198 question?
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.3%
  • 10x: 95.2%
  • 20x: 90.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acan A G 7: 79,099,983 T1501A probably benign Het
Acin1 G A 14: 54,664,391 A648V possibly damaging Het
Agap1 A G 1: 89,743,773 T401A possibly damaging Het
Anapc4 T G 5: 52,856,809 M440R probably damaging Het
Ankrd26 A G 6: 118,527,731 M739T probably benign Het
Brip1 T C 11: 86,110,447 E721G possibly damaging Het
Bzw1 A G 1: 58,402,906 E221G possibly damaging Het
Cenpm A C 15: 82,239,291 probably null Het
Exosc1 T A 19: 41,924,018 K143N probably damaging Het
Fgd5 T A 6: 92,066,247 L1236Q probably damaging Het
Grm3 C T 5: 9,504,872 V807I probably damaging Het
Kndc1 A G 7: 139,924,111 N1110S probably benign Het
Magi1 A T 6: 93,792,373 V17D possibly damaging Het
Mdn1 T G 4: 32,767,961 M5298R possibly damaging Het
Nlrp9c T A 7: 26,384,501 E551V probably damaging Het
Oacyl A C 18: 65,745,356 I457L probably benign Het
Olfr103 C T 17: 37,336,626 G202D probably damaging Het
Olfr1102 A T 2: 87,002,339 E123D possibly damaging Het
Olfr494 A G 7: 108,367,999 I170V probably benign Het
Rab11fip3 T C 17: 25,991,295 E996G probably damaging Het
Rabep1 T A 11: 70,923,146 S554T probably damaging Het
Rln1 T C 19: 29,334,520 E26G probably benign Het
Rpf1 A G 3: 146,517,804 silent Het
Sdk1 T C 5: 142,185,265 V1961A possibly damaging Het
Serpinb8 A T 1: 107,607,293 I365F probably damaging Het
Shank2 A G 7: 144,070,109 D277G probably damaging Het
Snapc4 ACTGCTGCTGCTGCTGCTGC ACTGCTGCTGCTGCTGC 2: 26,369,526 probably benign Het
Thsd7a T C 6: 12,332,007 T1269A possibly damaging Het
Ttll3 A G 6: 113,412,978 N776D probably benign Het
Unc80 A G 1: 66,606,614 E1483G possibly damaging Het
Ush2a A G 1: 188,753,606 D2971G probably benign Het
Zfp322a A G 13: 23,357,515 V19A probably benign Het
Zfp462 C A 4: 55,050,281 P2164T possibly damaging Het
Other mutations in Gemin6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00953:Gemin6 APN 17 80227865 missense possibly damaging 0.56
IGL02129:Gemin6 APN 17 80227926 missense probably damaging 1.00
R0197:Gemin6 UTSW 17 80228095 missense probably damaging 1.00
R0239:Gemin6 UTSW 17 80225710 missense probably damaging 1.00
R0239:Gemin6 UTSW 17 80225710 missense probably damaging 1.00
R0883:Gemin6 UTSW 17 80228095 missense probably damaging 1.00
R1995:Gemin6 UTSW 17 80227985 missense probably damaging 1.00
R4570:Gemin6 UTSW 17 80228069 nonsense probably null
R4885:Gemin6 UTSW 17 80227898 missense probably damaging 0.99
R5335:Gemin6 UTSW 17 80225755 missense probably damaging 1.00
R5445:Gemin6 UTSW 17 80227749 missense probably damaging 0.98
R5447:Gemin6 UTSW 17 80227749 missense probably damaging 0.98
R5451:Gemin6 UTSW 17 80227749 missense probably damaging 0.98
R5452:Gemin6 UTSW 17 80227749 missense probably damaging 0.98
R5522:Gemin6 UTSW 17 80227749 missense probably damaging 0.98
R5526:Gemin6 UTSW 17 80227749 missense probably damaging 0.98
R7291:Gemin6 UTSW 17 80227775 missense possibly damaging 0.61
R7576:Gemin6 UTSW 17 80225726 nonsense probably null
R7845:Gemin6 UTSW 17 80225661 missense probably benign 0.00
R8842:Gemin6 UTSW 17 80225686 missense possibly damaging 0.88
R8862:Gemin6 UTSW 17 80228003 missense probably damaging 1.00
Predicted Primers PCR Primer

Sequencing Primer
Posted On2016-10-05