Incidental Mutation 'R5525:Gemin6'
ID 431829
Institutional Source Beutler Lab
Gene Symbol Gemin6
Ensembl Gene ENSMUSG00000055760
Gene Name gem nuclear organelle associated protein 6
Synonyms 2810470M17Rik, 2610019B15Rik
MMRRC Submission 043083-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.720) question?
Stock # R5525 (G1)
Quality Score 225
Status Not validated
Chromosome 17
Chromosomal Location 80531870-80535926 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 80535178 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Glycine at position 46 (V46G)
Ref Sequence ENSEMBL: ENSMUSP00000063554 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069486]
AlphaFold Q9CX53
Predicted Effect probably damaging
Transcript: ENSMUST00000069486
AA Change: V46G

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000063554
Gene: ENSMUSG00000055760
AA Change: V46G

DomainStartEndE-ValueType
Pfam:Gemin6 1 166 9.7e-102 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156869
Meta Mutation Damage Score 0.4198 question?
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.3%
  • 10x: 95.2%
  • 20x: 90.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acan A G 7: 78,749,731 (GRCm39) T1501A probably benign Het
Acin1 G A 14: 54,901,848 (GRCm39) A648V possibly damaging Het
Agap1 A G 1: 89,671,495 (GRCm39) T401A possibly damaging Het
Anapc4 T G 5: 53,014,151 (GRCm39) M440R probably damaging Het
Ankrd26 A G 6: 118,504,692 (GRCm39) M739T probably benign Het
Brip1 T C 11: 86,001,273 (GRCm39) E721G possibly damaging Het
Bzw1 A G 1: 58,442,065 (GRCm39) E221G possibly damaging Het
Cenpm A C 15: 82,123,492 (GRCm39) probably null Het
Exosc1 T A 19: 41,912,457 (GRCm39) K143N probably damaging Het
Fgd5 T A 6: 92,043,228 (GRCm39) L1236Q probably damaging Het
Grm3 C T 5: 9,554,872 (GRCm39) V807I probably damaging Het
Kndc1 A G 7: 139,504,026 (GRCm39) N1110S probably benign Het
Magi1 A T 6: 93,769,354 (GRCm39) V17D possibly damaging Het
Mdn1 T G 4: 32,767,961 (GRCm39) M5298R possibly damaging Het
Nlrp9c T A 7: 26,083,926 (GRCm39) E551V probably damaging Het
Oacyl A C 18: 65,878,427 (GRCm39) I457L probably benign Het
Or12d13 C T 17: 37,647,517 (GRCm39) G202D probably damaging Het
Or5p69 A G 7: 107,967,206 (GRCm39) I170V probably benign Het
Or5t17 A T 2: 86,832,683 (GRCm39) E123D possibly damaging Het
Rab11fip3 T C 17: 26,210,269 (GRCm39) E996G probably damaging Het
Rabep1 T A 11: 70,813,972 (GRCm39) S554T probably damaging Het
Rln1 T C 19: 29,311,920 (GRCm39) E26G probably benign Het
Rpf1 A G 3: 146,223,559 (GRCm39) silent Het
Sdk1 T C 5: 142,171,020 (GRCm39) V1961A possibly damaging Het
Serpinb8 A T 1: 107,535,023 (GRCm39) I365F probably damaging Het
Shank2 A G 7: 143,623,846 (GRCm39) D277G probably damaging Het
Snapc4 ACTGCTGCTGCTGCTGCTGC ACTGCTGCTGCTGCTGC 2: 26,259,538 (GRCm39) probably benign Het
Thsd7a T C 6: 12,332,006 (GRCm39) T1269A possibly damaging Het
Ttll3 A G 6: 113,389,939 (GRCm39) N776D probably benign Het
Unc80 A G 1: 66,645,773 (GRCm39) E1483G possibly damaging Het
Ush2a A G 1: 188,485,803 (GRCm39) D2971G probably benign Het
Zfp322a A G 13: 23,541,685 (GRCm39) V19A probably benign Het
Zfp462 C A 4: 55,050,281 (GRCm39) P2164T possibly damaging Het
Other mutations in Gemin6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00953:Gemin6 APN 17 80,535,294 (GRCm39) missense possibly damaging 0.56
IGL02129:Gemin6 APN 17 80,535,355 (GRCm39) missense probably damaging 1.00
R0197:Gemin6 UTSW 17 80,535,524 (GRCm39) missense probably damaging 1.00
R0239:Gemin6 UTSW 17 80,533,139 (GRCm39) missense probably damaging 1.00
R0239:Gemin6 UTSW 17 80,533,139 (GRCm39) missense probably damaging 1.00
R0883:Gemin6 UTSW 17 80,535,524 (GRCm39) missense probably damaging 1.00
R1995:Gemin6 UTSW 17 80,535,414 (GRCm39) missense probably damaging 1.00
R4570:Gemin6 UTSW 17 80,535,498 (GRCm39) nonsense probably null
R4885:Gemin6 UTSW 17 80,535,327 (GRCm39) missense probably damaging 0.99
R5335:Gemin6 UTSW 17 80,533,184 (GRCm39) missense probably damaging 1.00
R5445:Gemin6 UTSW 17 80,535,178 (GRCm39) missense probably damaging 0.98
R5447:Gemin6 UTSW 17 80,535,178 (GRCm39) missense probably damaging 0.98
R5451:Gemin6 UTSW 17 80,535,178 (GRCm39) missense probably damaging 0.98
R5452:Gemin6 UTSW 17 80,535,178 (GRCm39) missense probably damaging 0.98
R5522:Gemin6 UTSW 17 80,535,178 (GRCm39) missense probably damaging 0.98
R5526:Gemin6 UTSW 17 80,535,178 (GRCm39) missense probably damaging 0.98
R7291:Gemin6 UTSW 17 80,535,204 (GRCm39) missense possibly damaging 0.61
R7576:Gemin6 UTSW 17 80,533,155 (GRCm39) nonsense probably null
R7845:Gemin6 UTSW 17 80,533,090 (GRCm39) missense probably benign 0.00
R8842:Gemin6 UTSW 17 80,533,115 (GRCm39) missense possibly damaging 0.88
R8862:Gemin6 UTSW 17 80,535,432 (GRCm39) missense probably damaging 1.00
R9203:Gemin6 UTSW 17 80,535,237 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ATCCACATTTAAGACAGATGGCC -3'
(R):5'- AGCCATTTCTTGAGGCTGGTC -3'

Sequencing Primer
(F):5'- AGGGGCCAAGCTTTTAATCC -3'
(R):5'- GGCTGGTCCTCTTCTCTTCCAG -3'
Posted On 2016-10-05