Incidental Mutation 'R5525:Rln1'
ID431831
Institutional Source Beutler Lab
Gene Symbol Rln1
Ensembl Gene ENSMUSG00000039097
Gene Namerelaxin 1
Synonymsrlx
MMRRC Submission 043083-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5525 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location29331170-29334670 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 29334520 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 26 (E26G)
Ref Sequence ENSEMBL: ENSMUSP00000043376 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044143]
Predicted Effect probably benign
Transcript: ENSMUST00000044143
AA Change: E26G

PolyPhen 2 Score 0.439 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000043376
Gene: ENSMUSG00000039097
AA Change: E26G

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
IlGF 33 185 6.34e-13 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182039
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.3%
  • 10x: 95.2%
  • 20x: 90.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Relaxins are known endocrine and autocrine/paracrine hormones, belonging to the insulin gene superfamily. In humans there are three non-allelic relaxin genes, RLN1, RLN2 and RLN3, where RLN1 and RLN2 share high sequence homology. The protein encoded by this gene is synthesized as a single-chain polypeptide but the active form consists of an A chain and a B chain linked by disulfide bonds. Relaxin is produced by the ovary, and targets the mammalian reproductive system to ripen the cervix, elongate the pubic symphysis and inhibit uterine contraction. It may have additional roles in enhancing sperm motility, regulating blood pressure, controlling heart rate and releasing oxytocin and vasopressin. [provided by RefSeq, Jan 2013]
PHENOTYPE: Inactivation of this locus is compatible with fertility but not normal mammary gland development. Postpartum, homozygous mutant females exhibit slight nipples that are insufficient for suckling. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acan A G 7: 79,099,983 T1501A probably benign Het
Acin1 G A 14: 54,664,391 A648V possibly damaging Het
Agap1 A G 1: 89,743,773 T401A possibly damaging Het
Anapc4 T G 5: 52,856,809 M440R probably damaging Het
Ankrd26 A G 6: 118,527,731 M739T probably benign Het
Brip1 T C 11: 86,110,447 E721G possibly damaging Het
Bzw1 A G 1: 58,402,906 E221G possibly damaging Het
Cenpm A C 15: 82,239,291 probably null Het
Exosc1 T A 19: 41,924,018 K143N probably damaging Het
Fgd5 T A 6: 92,066,247 L1236Q probably damaging Het
Gemin6 T G 17: 80,227,749 V46G probably damaging Het
Grm3 C T 5: 9,504,872 V807I probably damaging Het
Kndc1 A G 7: 139,924,111 N1110S probably benign Het
Magi1 A T 6: 93,792,373 V17D possibly damaging Het
Mdn1 T G 4: 32,767,961 M5298R possibly damaging Het
Nlrp9c T A 7: 26,384,501 E551V probably damaging Het
Oacyl A C 18: 65,745,356 I457L probably benign Het
Olfr103 C T 17: 37,336,626 G202D probably damaging Het
Olfr1102 A T 2: 87,002,339 E123D possibly damaging Het
Olfr494 A G 7: 108,367,999 I170V probably benign Het
Rab11fip3 T C 17: 25,991,295 E996G probably damaging Het
Rabep1 T A 11: 70,923,146 S554T probably damaging Het
Rpf1 A G 3: 146,517,804 silent Het
Sdk1 T C 5: 142,185,265 V1961A possibly damaging Het
Serpinb8 A T 1: 107,607,293 I365F probably damaging Het
Shank2 A G 7: 144,070,109 D277G probably damaging Het
Snapc4 ACTGCTGCTGCTGCTGCTGC ACTGCTGCTGCTGCTGC 2: 26,369,526 probably benign Het
Thsd7a T C 6: 12,332,007 T1269A possibly damaging Het
Ttll3 A G 6: 113,412,978 N776D probably benign Het
Unc80 A G 1: 66,606,614 E1483G possibly damaging Het
Ush2a A G 1: 188,753,606 D2971G probably benign Het
Zfp322a A G 13: 23,357,515 V19A probably benign Het
Zfp462 C A 4: 55,050,281 P2164T possibly damaging Het
Other mutations in Rln1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00515:Rln1 APN 19 29332014 missense possibly damaging 0.84
IGL01607:Rln1 APN 19 29331860 missense probably benign 0.02
IGL02415:Rln1 APN 19 29334398 missense probably damaging 0.97
R0184:Rln1 UTSW 19 29331936 nonsense probably null
R1670:Rln1 UTSW 19 29332068 missense possibly damaging 0.95
R1965:Rln1 UTSW 19 29334595 start codon destroyed probably null 0.53
R4434:Rln1 UTSW 19 29334562 missense possibly damaging 0.85
R4437:Rln1 UTSW 19 29334562 missense possibly damaging 0.85
R4438:Rln1 UTSW 19 29334562 missense possibly damaging 0.85
R6484:Rln1 UTSW 19 29334502 missense probably benign
R6648:Rln1 UTSW 19 29332121 missense probably benign 0.28
R7624:Rln1 UTSW 19 29332099 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TGAGGCTGGGGATCACAAAC -3'
(R):5'- CTCCCAAGGGATATAAAAGCCG -3'

Sequencing Primer
(F):5'- TGGTCAGCCAATGGGAAGC -3'
(R):5'- TATAAAAGCCGGATTGAGCACTG -3'
Posted On2016-10-05