Incidental Mutation 'R5525:Exosc1'
ID431832
Institutional Source Beutler Lab
Gene Symbol Exosc1
Ensembl Gene ENSMUSG00000034321
Gene Nameexosome component 1
Synonyms
MMRRC Submission 043083-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.946) question?
Stock #R5525 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location41922980-41933314 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 41924018 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 143 (K143N)
Ref Sequence ENSEMBL: ENSMUSP00000107751 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075280] [ENSMUST00000112123]
Predicted Effect probably damaging
Transcript: ENSMUST00000075280
AA Change: K184N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000074756
Gene: ENSMUSG00000034321
AA Change: K184N

DomainStartEndE-ValueType
Pfam:ECR1_N 8 44 3.8e-12 PFAM
S1 66 147 3.75e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000112123
AA Change: K143N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107751
Gene: ENSMUSG00000034321
AA Change: K143N

DomainStartEndE-ValueType
Pfam:ECR1_N 7 41 3.9e-14 PFAM
Pfam:EXOSC1 64 94 7.9e-10 PFAM
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.3%
  • 10x: 95.2%
  • 20x: 90.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a core component of the exosome. The mammalian exosome is required for rapid degradation of AU rich element-containing RNAs but not for poly(A) shortening. The association of this protein with the exosome is mediated by protein-protein interactions with ribosomal RNA-processing protein 42 and ribosomal RNA-processing protein 46. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jan 2016]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acan A G 7: 79,099,983 T1501A probably benign Het
Acin1 G A 14: 54,664,391 A648V possibly damaging Het
Agap1 A G 1: 89,743,773 T401A possibly damaging Het
Anapc4 T G 5: 52,856,809 M440R probably damaging Het
Ankrd26 A G 6: 118,527,731 M739T probably benign Het
Brip1 T C 11: 86,110,447 E721G possibly damaging Het
Bzw1 A G 1: 58,402,906 E221G possibly damaging Het
Cenpm A C 15: 82,239,291 probably null Het
Fgd5 T A 6: 92,066,247 L1236Q probably damaging Het
Gemin6 T G 17: 80,227,749 V46G probably damaging Het
Grm3 C T 5: 9,504,872 V807I probably damaging Het
Kndc1 A G 7: 139,924,111 N1110S probably benign Het
Magi1 A T 6: 93,792,373 V17D possibly damaging Het
Mdn1 T G 4: 32,767,961 M5298R possibly damaging Het
Nlrp9c T A 7: 26,384,501 E551V probably damaging Het
Oacyl A C 18: 65,745,356 I457L probably benign Het
Olfr103 C T 17: 37,336,626 G202D probably damaging Het
Olfr1102 A T 2: 87,002,339 E123D possibly damaging Het
Olfr494 A G 7: 108,367,999 I170V probably benign Het
Rab11fip3 T C 17: 25,991,295 E996G probably damaging Het
Rabep1 T A 11: 70,923,146 S554T probably damaging Het
Rln1 T C 19: 29,334,520 E26G probably benign Het
Rpf1 A G 3: 146,517,804 silent Het
Sdk1 T C 5: 142,185,265 V1961A possibly damaging Het
Serpinb8 A T 1: 107,607,293 I365F probably damaging Het
Shank2 A G 7: 144,070,109 D277G probably damaging Het
Snapc4 ACTGCTGCTGCTGCTGCTGC ACTGCTGCTGCTGCTGC 2: 26,369,526 probably benign Het
Thsd7a T C 6: 12,332,007 T1269A possibly damaging Het
Ttll3 A G 6: 113,412,978 N776D probably benign Het
Unc80 A G 1: 66,606,614 E1483G possibly damaging Het
Ush2a A G 1: 188,753,606 D2971G probably benign Het
Zfp322a A G 13: 23,357,515 V19A probably benign Het
Zfp462 C A 4: 55,050,281 P2164T possibly damaging Het
Other mutations in Exosc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0931:Exosc1 UTSW 19 41933237 unclassified probably benign
R1471:Exosc1 UTSW 19 41924718 missense probably damaging 1.00
R1791:Exosc1 UTSW 19 41928085 missense probably benign 0.30
R2265:Exosc1 UTSW 19 41931418 missense probably damaging 0.99
R4845:Exosc1 UTSW 19 41931358 missense possibly damaging 0.87
R5321:Exosc1 UTSW 19 41924060 nonsense probably null
R5875:Exosc1 UTSW 19 41928103 missense probably damaging 1.00
R6172:Exosc1 UTSW 19 41924003 missense probably damaging 1.00
R7695:Exosc1 UTSW 19 41928080 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- ATTTCCGGCACATTGTTTCAAG -3'
(R):5'- AGAGAAACGTTCCCTTAGTGCTAG -3'

Sequencing Primer
(F):5'- CCGGCACATTGTTTCAAGAGATG -3'
(R):5'- GTTCCCTTAGTGCTAGAGATGACAC -3'
Posted On2016-10-05