Incidental Mutation 'R5526:Tasp1'
ID431843
Institutional Source Beutler Lab
Gene Symbol Tasp1
Ensembl Gene ENSMUSG00000039033
Gene Nametaspase, threonine aspartase 1
Synonyms
MMRRC Submission 043084-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.601) question?
Stock #R5526 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location139833480-140066805 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 140008789 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 105 (S105T)
Ref Sequence ENSEMBL: ENSMUSP00000105706 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046656] [ENSMUST00000099304] [ENSMUST00000110079]
Predicted Effect probably damaging
Transcript: ENSMUST00000046656
AA Change: S105T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000039546
Gene: ENSMUSG00000039033
AA Change: S105T

DomainStartEndE-ValueType
Pfam:Asparaginase_2 42 346 1.1e-50 PFAM
low complexity region 347 358 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000099304
AA Change: S105T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000096907
Gene: ENSMUSG00000039033
AA Change: S105T

DomainStartEndE-ValueType
Pfam:Asparaginase_2 42 286 1.1e-46 PFAM
low complexity region 310 321 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000110079
AA Change: S105T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105706
Gene: ENSMUSG00000039033
AA Change: S105T

DomainStartEndE-ValueType
Pfam:Asparaginase_2 42 348 1.3e-62 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124949
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.3%
  • 10x: 95.2%
  • 20x: 90.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an endopeptidase that cleaves specific substrates following aspartate residues. The encoded protein undergoes posttranslational autoproteolytic processing to generate alpha and beta subunits, which reassemble into the active alpha2-beta2 heterotetramer. It is required to cleave MLL, a protein required for the maintenance of HOX gene expression, and TFIIA, a basal transcription factor. Alternatively spliced transcript variants have been described, but their biological validity has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele display prenatal and early postnatal lethality, reduced body size, impaired suckling behavior, homeotic transformations of the axial skeleton, and cell cycle defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik T C 4: 42,972,125 V486A possibly damaging Het
Abca12 A T 1: 71,292,446 M1315K probably benign Het
Abcc4 C T 14: 118,631,037 V168I probably benign Het
Add3 T A 19: 53,226,607 L71Q probably damaging Het
Agbl5 G A 5: 30,893,903 probably null Het
Angpt1 A G 15: 42,512,341 L173P probably damaging Het
BC067074 T C 13: 113,367,893 V1852A probably benign Het
Crls1 T A 2: 132,861,245 M205K possibly damaging Het
Dhtkd1 A T 2: 5,911,851 N671K probably damaging Het
Dmbt1 A T 7: 131,041,190 D246V probably damaging Het
Dolk G A 2: 30,285,808 A75V probably damaging Het
Dtna T A 18: 23,646,230 V623E probably damaging Het
Elavl3 T C 9: 22,036,326 T106A probably benign Het
Ergic1 T C 17: 26,624,678 C41R probably damaging Het
Fat2 T A 11: 55,269,361 I3309F possibly damaging Het
Fbn1 C A 2: 125,365,639 R978L possibly damaging Het
Fzd6 A T 15: 39,031,164 S242C possibly damaging Het
Galntl6 T A 8: 58,472,970 H87L probably benign Het
Gatad2a T C 8: 69,935,941 E32G probably damaging Het
Gemin6 T G 17: 80,227,749 V46G probably damaging Het
Gm11541 G T 11: 94,704,118 H41Q unknown Het
Has3 A G 8: 106,873,947 T14A probably damaging Het
Kmt2b A G 7: 30,580,444 L1377P probably damaging Het
Lcorl T C 5: 45,733,727 N428S probably benign Het
Lipo5 A T 19: 33,467,884 V95D unknown Het
Lrp1 A T 10: 127,555,724 V2942D probably benign Het
Map1a T C 2: 121,305,662 S2082P probably damaging Het
Mast4 T C 13: 102,754,215 S852G possibly damaging Het
Mlh3 A T 12: 85,269,373 L13* probably null Het
Ncam2 C T 16: 81,434,878 R77* probably null Het
Nlrp9c T A 7: 26,382,366 N645I possibly damaging Het
Olfr109 T A 17: 37,467,112 L302Q unknown Het
Olfr1126 T C 2: 87,457,765 I200T probably benign Het
Olfr128 T A 17: 37,924,492 *309K probably null Het
Olfr857 C A 9: 19,713,698 Y290* probably null Het
Olfr965 A T 9: 39,719,596 Y123F possibly damaging Het
Pex12 A G 11: 83,296,264 V286A possibly damaging Het
Phax C T 18: 56,584,310 T275I probably damaging Het
Phf21b A G 15: 84,791,805 V335A probably benign Het
Psg18 A T 7: 18,349,348 L173H probably damaging Het
Rab3ip T C 10: 116,918,929 T209A possibly damaging Het
Ralgapb T C 2: 158,432,785 V202A probably damaging Het
Rpn2 T C 2: 157,323,267 L611P probably damaging Het
Runx2 T G 17: 44,724,862 T148P probably damaging Het
Sbpl C A 17: 23,954,649 D50Y probably damaging Het
Scn5a G A 9: 119,521,171 P879L probably damaging Het
Sfn T C 4: 133,601,604 R56G probably damaging Het
Tas2r138 C T 6: 40,612,980 A111T probably benign Het
Tmem225 T G 9: 40,150,706 H205Q possibly damaging Het
Tmprss7 A G 16: 45,660,904 S640P probably damaging Het
Utp4 G A 8: 106,917,633 A535T possibly damaging Het
Vmn1r203 A T 13: 22,524,103 D18V probably benign Het
Vmn2r58 A G 7: 41,872,645 L9P probably benign Het
Zcchc2 T A 1: 106,030,254 C420* probably null Het
Zfp804a A G 2: 82,258,590 D921G probably benign Het
Other mutations in Tasp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01110:Tasp1 APN 2 139977618 missense probably damaging 1.00
IGL01476:Tasp1 APN 2 140008773 missense probably benign 0.01
IGL02876:Tasp1 APN 2 139834363 missense probably benign 0.45
PIT4449001:Tasp1 UTSW 2 139910535 missense possibly damaging 0.67
R0352:Tasp1 UTSW 2 139951458 critical splice donor site probably null
R0381:Tasp1 UTSW 2 139951483 missense probably damaging 1.00
R1056:Tasp1 UTSW 2 140008764 missense possibly damaging 0.94
R1350:Tasp1 UTSW 2 140057421 missense probably damaging 1.00
R1836:Tasp1 UTSW 2 139951557 missense probably damaging 1.00
R2005:Tasp1 UTSW 2 139977678 missense probably damaging 1.00
R2129:Tasp1 UTSW 2 140048244 missense possibly damaging 0.75
R2259:Tasp1 UTSW 2 139951506 missense probably damaging 1.00
R2321:Tasp1 UTSW 2 140057412 missense probably benign 0.05
R3700:Tasp1 UTSW 2 139910554 missense probably benign 0.00
R3842:Tasp1 UTSW 2 139951501 missense probably damaging 1.00
R5724:Tasp1 UTSW 2 140057419 missense probably damaging 0.99
R6345:Tasp1 UTSW 2 139951537 missense probably damaging 1.00
R6533:Tasp1 UTSW 2 139834357 makesense probably null
R7723:Tasp1 UTSW 2 139985131 missense probably damaging 1.00
R7796:Tasp1 UTSW 2 140008785 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TGAGCTACATCCCTAACACTGG -3'
(R):5'- GTCACTAGAGAAGGACTGGC -3'

Sequencing Primer
(F):5'- AGAGGGTTTGTTTCAACATTCC -3'
(R):5'- TCACTAGAGAAGGACTGGCATTTC -3'
Posted On2016-10-05