Incidental Mutation 'R0478:Olfr1126'
ID43185
Institutional Source Beutler Lab
Gene Symbol Olfr1126
Ensembl Gene ENSMUSG00000058194
Gene Nameolfactory receptor 1126
SynonymsGA_x6K02T2Q125-48959068-48960012, MOR264-5
MMRRC Submission 038678-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.077) question?
Stock #R0478 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location87453962-87458911 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 87458026 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 287 (V287E)
Ref Sequence ENSEMBL: ENSMUSP00000150504 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071355] [ENSMUST00000213366]
Predicted Effect probably damaging
Transcript: ENSMUST00000071355
AA Change: V287E

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000071313
Gene: ENSMUSG00000058194
AA Change: V287E

DomainStartEndE-ValueType
Pfam:7tm_4 37 314 8.6e-52 PFAM
Pfam:7tm_1 47 296 8.9e-19 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213366
AA Change: V287E

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.0%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 100% (49/49)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432E11Rik A T 7: 29,562,589 noncoding transcript Het
4930556J24Rik T G 11: 3,976,259 probably benign Het
Acnat1 T G 4: 49,450,901 D70A probably damaging Het
Adnp2 A G 18: 80,129,334 V620A probably benign Het
Aldoart1 T A 4: 72,852,343 H21L probably benign Het
Birc3 A G 9: 7,860,347 V290A probably damaging Het
Bpifb3 C T 2: 153,931,480 probably benign Het
Camta1 C A 4: 151,075,140 R1614L probably damaging Het
Clmn A G 12: 104,785,491 M235T probably damaging Het
Dmbt1 A G 7: 131,041,187 E245G possibly damaging Het
Epgn G T 5: 91,031,128 V36L probably benign Het
Ets2 C A 16: 95,716,262 P346Q probably damaging Het
Fam222b T C 11: 78,153,856 L81P probably damaging Het
Fancf A C 7: 51,861,692 L188R probably damaging Het
Fibin T C 2: 110,362,734 D21G possibly damaging Het
Fzd6 A G 15: 39,034,034 probably null Het
Gbp4 T A 5: 105,119,433 Q540L probably benign Het
Greb1l T A 18: 10,509,281 L531Q probably damaging Het
Il5ra A G 6: 106,738,462 V137A probably benign Het
Kif26a G A 12: 112,175,789 A826T probably damaging Het
Kiz T C 2: 146,942,158 V537A possibly damaging Het
Klhl32 C T 4: 24,792,777 G15D probably damaging Het
Kmt2d G A 15: 98,853,581 probably benign Het
Lbp T C 2: 158,317,528 probably benign Het
Mmp25 T C 17: 23,632,782 T318A probably benign Het
Mrpl50 A G 4: 49,514,513 C53R probably damaging Het
Msl3l2 G C 10: 56,115,315 E45D probably damaging Het
Nfxl1 A G 5: 72,524,645 probably null Het
Noc3l A G 19: 38,810,006 probably null Het
Olfr1375 T C 11: 51,048,712 S202P probably benign Het
Pgm5 A T 19: 24,834,869 S100T possibly damaging Het
Pi4ka C T 16: 17,309,311 G1093S possibly damaging Het
Pitrm1 T A 13: 6,559,395 S350T probably damaging Het
Ptk2b G T 14: 66,213,372 N48K probably damaging Het
Sept3 T C 15: 82,290,806 L172P probably damaging Het
Sirt3 A T 7: 140,878,114 C41S probably benign Het
Sphkap C T 1: 83,278,711 R152H probably damaging Het
St3gal1 T C 15: 67,113,730 Y25C probably damaging Het
Tbc1d31 T C 15: 57,932,536 F175S probably damaging Het
Tfdp2 T A 9: 96,290,583 D43E probably benign Het
Tgm1 G A 14: 55,700,334 Q773* probably null Het
Tmc3 A T 7: 83,622,152 R837S possibly damaging Het
Unc13a A G 8: 71,651,148 V880A possibly damaging Het
Vmn1r237 T A 17: 21,314,819 V268E probably damaging Het
Zan C T 5: 137,400,526 probably benign Het
Zfp760 G T 17: 21,722,014 E57* probably null Het
Other mutations in Olfr1126
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Olfr1126 APN 2 87457927 missense probably damaging 1.00
IGL01875:Olfr1126 APN 2 87457310 missense probably damaging 0.99
IGL02207:Olfr1126 APN 2 87457450 missense probably benign 0.22
R0238:Olfr1126 UTSW 2 87458037 missense probably benign 0.00
R0238:Olfr1126 UTSW 2 87458037 missense probably benign 0.00
R0239:Olfr1126 UTSW 2 87458037 missense probably benign 0.00
R0239:Olfr1126 UTSW 2 87458037 missense probably benign 0.00
R1055:Olfr1126 UTSW 2 87457437 small deletion probably benign
R1438:Olfr1126 UTSW 2 87457992 missense probably benign 0.00
R1625:Olfr1126 UTSW 2 87457672 missense probably damaging 1.00
R1912:Olfr1126 UTSW 2 87457383 missense probably damaging 1.00
R3052:Olfr1126 UTSW 2 87457903 missense probably damaging 1.00
R4638:Olfr1126 UTSW 2 87457983 missense possibly damaging 0.60
R5102:Olfr1126 UTSW 2 87457794 missense probably benign
R5526:Olfr1126 UTSW 2 87457765 missense probably benign 0.01
R5825:Olfr1126 UTSW 2 87457450 missense probably benign 0.22
R5965:Olfr1126 UTSW 2 87458037 missense probably benign 0.14
R6505:Olfr1126 UTSW 2 87457927 missense probably damaging 1.00
R7494:Olfr1126 UTSW 2 87457568 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCCACCATTCTGAAGTTGCCAACA -3'
(R):5'- ACTGTGGTTCACACTGCACTTATTTGT -3'

Sequencing Primer
(F):5'- GTTGCCAACAGCCACAGG -3'
(R):5'- AGCTATCATTCAAAATGGCACAG -3'
Posted On2013-05-23