Incidental Mutation 'R5526:Galntl6'
ID431855
Institutional Source Beutler Lab
Gene Symbol Galntl6
Ensembl Gene ENSMUSG00000096914
Gene NameUDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase-like 6
Synonyms
MMRRC Submission 043084-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.067) question?
Stock #R5526 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location57774052-58912640 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 58472970 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 87 (H87L)
Ref Sequence ENSEMBL: ENSMUSP00000145321 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000146513] [ENSMUST00000188531] [ENSMUST00000204128]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000077447
SMART Domains Protein: ENSMUSP00000076660
Gene: ENSMUSG00000061864

DomainStartEndE-ValueType
transmembrane domain 13 31 N/A INTRINSIC
Pfam:Glycos_transf_2 143 188 4.9e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000146513
SMART Domains Protein: ENSMUSP00000118306
Gene: ENSMUSG00000096914

DomainStartEndE-ValueType
transmembrane domain 13 30 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000188531
AA Change: H42L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000139677
Gene: ENSMUSG00000096914
AA Change: H42L

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 98 139 2.4e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000204128
AA Change: H87L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000145321
Gene: ENSMUSG00000096914
AA Change: H87L

DomainStartEndE-ValueType
transmembrane domain 13 31 N/A INTRINSIC
Pfam:Glyco_tranf_2_3 140 404 2.1e-9 PFAM
Pfam:Glycos_transf_2 143 328 7.3e-33 PFAM
Pfam:Glyco_tranf_2_2 143 356 1.2e-8 PFAM
Pfam:Glyco_transf_7C 297 371 6.2e-12 PFAM
RICIN 452 585 7.9e-21 SMART
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.3%
  • 10x: 95.2%
  • 20x: 90.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik T C 4: 42,972,125 V486A possibly damaging Het
Abca12 A T 1: 71,292,446 M1315K probably benign Het
Abcc4 C T 14: 118,631,037 V168I probably benign Het
Add3 T A 19: 53,226,607 L71Q probably damaging Het
Agbl5 G A 5: 30,893,903 probably null Het
Angpt1 A G 15: 42,512,341 L173P probably damaging Het
BC067074 T C 13: 113,367,893 V1852A probably benign Het
Crls1 T A 2: 132,861,245 M205K possibly damaging Het
Dhtkd1 A T 2: 5,911,851 N671K probably damaging Het
Dmbt1 A T 7: 131,041,190 D246V probably damaging Het
Dolk G A 2: 30,285,808 A75V probably damaging Het
Dtna T A 18: 23,646,230 V623E probably damaging Het
Elavl3 T C 9: 22,036,326 T106A probably benign Het
Ergic1 T C 17: 26,624,678 C41R probably damaging Het
Fat2 T A 11: 55,269,361 I3309F possibly damaging Het
Fbn1 C A 2: 125,365,639 R978L possibly damaging Het
Fzd6 A T 15: 39,031,164 S242C possibly damaging Het
Gatad2a T C 8: 69,935,941 E32G probably damaging Het
Gemin6 T G 17: 80,227,749 V46G probably damaging Het
Gm11541 G T 11: 94,704,118 H41Q unknown Het
Has3 A G 8: 106,873,947 T14A probably damaging Het
Kmt2b A G 7: 30,580,444 L1377P probably damaging Het
Lcorl T C 5: 45,733,727 N428S probably benign Het
Lipo5 A T 19: 33,467,884 V95D unknown Het
Lrp1 A T 10: 127,555,724 V2942D probably benign Het
Map1a T C 2: 121,305,662 S2082P probably damaging Het
Mast4 T C 13: 102,754,215 S852G possibly damaging Het
Mlh3 A T 12: 85,269,373 L13* probably null Het
Ncam2 C T 16: 81,434,878 R77* probably null Het
Nlrp9c T A 7: 26,382,366 N645I possibly damaging Het
Olfr109 T A 17: 37,467,112 L302Q unknown Het
Olfr1126 T C 2: 87,457,765 I200T probably benign Het
Olfr128 T A 17: 37,924,492 *309K probably null Het
Olfr857 C A 9: 19,713,698 Y290* probably null Het
Olfr965 A T 9: 39,719,596 Y123F possibly damaging Het
Pex12 A G 11: 83,296,264 V286A possibly damaging Het
Phax C T 18: 56,584,310 T275I probably damaging Het
Phf21b A G 15: 84,791,805 V335A probably benign Het
Psg18 A T 7: 18,349,348 L173H probably damaging Het
Rab3ip T C 10: 116,918,929 T209A possibly damaging Het
Ralgapb T C 2: 158,432,785 V202A probably damaging Het
Rpn2 T C 2: 157,323,267 L611P probably damaging Het
Runx2 T G 17: 44,724,862 T148P probably damaging Het
Sbpl C A 17: 23,954,649 D50Y probably damaging Het
Scn5a G A 9: 119,521,171 P879L probably damaging Het
Sfn T C 4: 133,601,604 R56G probably damaging Het
Tas2r138 C T 6: 40,612,980 A111T probably benign Het
Tasp1 A T 2: 140,008,789 S105T probably damaging Het
Tmem225 T G 9: 40,150,706 H205Q possibly damaging Het
Tmprss7 A G 16: 45,660,904 S640P probably damaging Het
Utp4 G A 8: 106,917,633 A535T possibly damaging Het
Vmn1r203 A T 13: 22,524,103 D18V probably benign Het
Vmn2r58 A G 7: 41,872,645 L9P probably benign Het
Zcchc2 T A 1: 106,030,254 C420* probably null Het
Zfp804a A G 2: 82,258,590 D921G probably benign Het
Other mutations in Galntl6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00489:Galntl6 APN 8 57857540 missense probably damaging 1.00
IGL00557:Galntl6 APN 8 58911417 missense possibly damaging 0.71
IGL01140:Galntl6 APN 8 57958322 missense probably damaging 1.00
IGL01412:Galntl6 APN 8 57777294 missense probably damaging 0.99
IGL01458:Galntl6 APN 8 58427709 missense probably damaging 1.00
IGL01575:Galntl6 APN 8 58427676 intron probably benign
IGL01700:Galntl6 APN 8 57958460 splice site probably benign
IGL01710:Galntl6 APN 8 58535968 missense probably damaging 0.97
IGL02611:Galntl6 APN 8 57958416 missense probably damaging 1.00
IGL02880:Galntl6 APN 8 57804272 missense probably benign 0.44
IGL03129:Galntl6 APN 8 58427716 missense probably damaging 1.00
IGL03215:Galntl6 APN 8 58911402 missense probably benign 0.00
IGL03249:Galntl6 APN 8 57777176 utr 3 prime probably benign
Indubitably UTSW 8 58427770 missense probably damaging 1.00
PIT4677001:Galntl6 UTSW 8 57857587 missense probably damaging 1.00
R0600:Galntl6 UTSW 8 57837183 splice site probably null
R0731:Galntl6 UTSW 8 58535984 missense probably benign
R0961:Galntl6 UTSW 8 58911340 missense probably benign
R1381:Galntl6 UTSW 8 58472955 missense probably damaging 0.99
R2137:Galntl6 UTSW 8 58535905 critical splice donor site probably null
R4632:Galntl6 UTSW 8 58427823 missense probably damaging 1.00
R4731:Galntl6 UTSW 8 58427813 missense probably damaging 1.00
R4732:Galntl6 UTSW 8 58427813 missense probably damaging 1.00
R4733:Galntl6 UTSW 8 58427813 missense probably damaging 1.00
R4920:Galntl6 UTSW 8 58427773 missense probably damaging 0.97
R4964:Galntl6 UTSW 8 58699911 intron probably benign
R5357:Galntl6 UTSW 8 57884463 missense probably damaging 0.99
R5951:Galntl6 UTSW 8 57962402 missense probably benign 0.06
R5965:Galntl6 UTSW 8 57857531 missense probably benign 0.03
R6260:Galntl6 UTSW 8 57884481 missense probably damaging 1.00
R6368:Galntl6 UTSW 8 58911441 missense probably damaging 1.00
R6695:Galntl6 UTSW 8 58427770 missense probably damaging 1.00
R7593:Galntl6 UTSW 8 57777259 missense probably damaging 1.00
R7780:Galntl6 UTSW 8 58427699 critical splice donor site probably null
R7833:Galntl6 UTSW 8 57857537 missense probably benign
R7871:Galntl6 UTSW 8 57837188 missense probably damaging 0.98
R7916:Galntl6 UTSW 8 57857537 missense probably benign
R7954:Galntl6 UTSW 8 57837188 missense probably damaging 0.98
Z1176:Galntl6 UTSW 8 57857558 missense not run
Predicted Primers PCR Primer
(F):5'- AACACAGCTGACATTCTTTCAG -3'
(R):5'- TCCACATGCAGGTACACTTACATAC -3'

Sequencing Primer
(F):5'- CACAGCTGACATTCTTTCAGAATTTC -3'
(R):5'- GTCTTTGGGGGTATTGTTTTATTTG -3'
Posted On2016-10-05