Mutagenetix > Incidental Mutations

Incidental Mutation 'R5526:Olfr857'

431859

Institutional Source

Beutler Lab

Gene Symbol

Olfr857

Ensembl Gene

ENSMUSG00000094678

Gene Name

olfactory receptor 857

Synonyms

MOR146-8P, GA_x6K02T2PVTD-13452606-13453535

MMRRC Submission

043084-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.097) question?

Stock #

R5526 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

19709433-19714930 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

C to A at 19713698 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Stop codon at position 290 (Y290*)

Ref Sequence

ENSEMBL: ENSMUSP00000150889 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000077023] [ENSMUST00000212013] [ENSMUST00000217450]

Predicted Effect

probably null
Transcript: ENSMUST00000077023
AA Change: Y290*

SMART Domains

Protein: ENSMUSP00000076281
Gene: ENSMUSG00000094678
AA Change: Y290*

Domain	Start	End	E-Value	Type
Pfam:7tm_4	31	308	2.5e-49	PFAM
Pfam:7TM_GPCR_Srsx	35	304	1.5e-5	PFAM
Pfam:7tm_1	41	290	9.4e-21	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000212013
AA Change: Y290*

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000212753

Predicted Effect

probably null
Transcript: ENSMUST00000217450
AA Change: Y290*

Coding Region Coverage

1x: 98.3%
3x: 97.3%
10x: 95.2%
20x: 90.7%

Validation Efficiency

MGI Phenotype

FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700022I11Rik	T	C	4: 42,972,125	V486A	possibly damaging	Het
Abca12	A	T	1: 71,292,446	M1315K	probably benign	Het
Abcc4	C	T	14: 118,631,037	V168I	probably benign	Het
Add3	T	A	19: 53,226,607	L71Q	probably damaging	Het
Agbl5	G	A	5: 30,893,903		probably null	Het
Angpt1	A	G	15: 42,512,341	L173P	probably damaging	Het
BC067074	T	C	13: 113,367,893	V1852A	probably benign	Het
Crls1	T	A	2: 132,861,245	M205K	possibly damaging	Het
Dhtkd1	A	T	2: 5,911,851	N671K	probably damaging	Het
Dmbt1	A	T	7: 131,041,190	D246V	probably damaging	Het
Dolk	G	A	2: 30,285,808	A75V	probably damaging	Het
Dtna	T	A	18: 23,646,230	V623E	probably damaging	Het
Elavl3	T	C	9: 22,036,326	T106A	probably benign	Het
Ergic1	T	C	17: 26,624,678	C41R	probably damaging	Het
Fat2	T	A	11: 55,269,361	I3309F	possibly damaging	Het
Fbn1	C	A	2: 125,365,639	R978L	possibly damaging	Het
Fzd6	A	T	15: 39,031,164	S242C	possibly damaging	Het
Galntl6	T	A	8: 58,472,970	H87L	probably benign	Het
Gatad2a	T	C	8: 69,935,941	E32G	probably damaging	Het
Gemin6	T	G	17: 80,227,749	V46G	probably damaging	Het
Gm11541	G	T	11: 94,704,118	H41Q	unknown	Het
Has3	A	G	8: 106,873,947	T14A	probably damaging	Het
Kmt2b	A	G	7: 30,580,444	L1377P	probably damaging	Het
Lcorl	T	C	5: 45,733,727	N428S	probably benign	Het
Lipo5	A	T	19: 33,467,884	V95D	unknown	Het
Lrp1	A	T	10: 127,555,724	V2942D	probably benign	Het
Map1a	T	C	2: 121,305,662	S2082P	probably damaging	Het
Mast4	T	C	13: 102,754,215	S852G	possibly damaging	Het
Mlh3	A	T	12: 85,269,373	L13*	probably null	Het
Ncam2	C	T	16: 81,434,878	R77*	probably null	Het
Nlrp9c	T	A	7: 26,382,366	N645I	possibly damaging	Het
Olfr109	T	A	17: 37,467,112	L302Q	unknown	Het
Olfr1126	T	C	2: 87,457,765	I200T	probably benign	Het
Olfr128	T	A	17: 37,924,492	*309K	probably null	Het
Olfr965	A	T	9: 39,719,596	Y123F	possibly damaging	Het
Pex12	A	G	11: 83,296,264	V286A	possibly damaging	Het
Phax	C	T	18: 56,584,310	T275I	probably damaging	Het
Phf21b	A	G	15: 84,791,805	V335A	probably benign	Het
Psg18	A	T	7: 18,349,348	L173H	probably damaging	Het
Rab3ip	T	C	10: 116,918,929	T209A	possibly damaging	Het
Ralgapb	T	C	2: 158,432,785	V202A	probably damaging	Het
Rpn2	T	C	2: 157,323,267	L611P	probably damaging	Het
Runx2	T	G	17: 44,724,862	T148P	probably damaging	Het
Sbpl	C	A	17: 23,954,649	D50Y	probably damaging	Het
Scn5a	G	A	9: 119,521,171	P879L	probably damaging	Het
Sfn	T	C	4: 133,601,604	R56G	probably damaging	Het
Tas2r138	C	T	6: 40,612,980	A111T	probably benign	Het
Tasp1	A	T	2: 140,008,789	S105T	probably damaging	Het
Tmem225	T	G	9: 40,150,706	H205Q	possibly damaging	Het
Tmprss7	A	G	16: 45,660,904	S640P	probably damaging	Het
Utp4	G	A	8: 106,917,633	A535T	possibly damaging	Het
Vmn1r203	A	T	13: 22,524,103	D18V	probably benign	Het
Vmn2r58	A	G	7: 41,872,645	L9P	probably benign	Het
Zcchc2	T	A	1: 106,030,254	C420*	probably null	Het
Zfp804a	A	G	2: 82,258,590	D921G	probably benign	Het

Other mutations in Olfr857

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01510:Olfr857	APN	9	19713279	missense	probably benign	0.00
IGL01919:Olfr857	APN	9	19713342	missense	probably benign	0.00
IGL02157:Olfr857	APN	9	19713289	missense	probably benign	0.07
IGL02550:Olfr857	APN	9	19713047	missense	possibly damaging	0.92
IGL03329:Olfr857	APN	9	19713301	missense	probably benign	0.16
IGL02799:Olfr857	UTSW	9	19713018	missense	probably damaging	0.99
R0356:Olfr857	UTSW	9	19713447	missense	probably damaging	1.00
R0927:Olfr857	UTSW	9	19713649	missense	probably benign	0.39
R1161:Olfr857	UTSW	9	19713180	missense	probably damaging	1.00
R1848:Olfr857	UTSW	9	19713090	missense	probably benign	0.01
R5191:Olfr857	UTSW	9	19713334	missense	probably damaging	0.98
R5216:Olfr857	UTSW	9	19713289	missense	probably benign	0.07
R5259:Olfr857	UTSW	9	19712813	intron	probably null
R5342:Olfr857	UTSW	9	19713037	missense	probably damaging	1.00
R5506:Olfr857	UTSW	9	19713274	missense	possibly damaging	0.61
R5594:Olfr857	UTSW	9	19713006	missense	probably damaging	0.99
R5928:Olfr857	UTSW	9	19713753	missense	probably benign	0.02
R6569:Olfr857	UTSW	9	19713342	missense	probably benign	0.00
R6858:Olfr857	UTSW	9	19713469	missense	probably damaging	0.98
R7077:Olfr857	UTSW	9	19713132	missense	probably benign
R7378:Olfr857	UTSW	9	19712887	missense	probably damaging	1.00
R7771:Olfr857	UTSW	9	19713471	missense	probably benign
R8038:Olfr857	UTSW	9	19713680	missense	not run

Predicted Primers

PCR Primer
(F):5'- CCATCACTGTTAGGGAAATATAAAGCC -3'
(R):5'- TGGACAAGTGCATCAAGATAGACC -3'

Sequencing Primer
(F):5'- GGGAAATATAAAGCCTTCTCTACCTG -3'
(R):5'- CCACAATTAGTTATGTGACTCAG -3'

Posted On

2016-10-05