Incidental Mutation 'R5526:Olfr965'
ID431861
Institutional Source Beutler Lab
Gene Symbol Olfr965
Ensembl Gene ENSMUSG00000095839
Gene Nameolfactory receptor 965
SynonymsGA_x6K02T2PVTD-33416730-33417668, MOR171-28
MMRRC Submission 043084-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock #R5526 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location39711353-39720614 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 39719596 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 123 (Y123F)
Ref Sequence ENSEMBL: ENSMUSP00000150401 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069342] [ENSMUST00000213335] [ENSMUST00000215164]
Predicted Effect possibly damaging
Transcript: ENSMUST00000069342
AA Change: Y123F

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000069696
Gene: ENSMUSG00000095839
AA Change: Y123F

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 1.4e-47 PFAM
Pfam:7tm_1 41 290 4.2e-24 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000213335
AA Change: Y123F

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214875
Predicted Effect possibly damaging
Transcript: ENSMUST00000215164
AA Change: Y123F

PolyPhen 2 Score 0.953 (Sensitivity: 0.79; Specificity: 0.95)
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.3%
  • 10x: 95.2%
  • 20x: 90.7%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik T C 4: 42,972,125 V486A possibly damaging Het
Abca12 A T 1: 71,292,446 M1315K probably benign Het
Abcc4 C T 14: 118,631,037 V168I probably benign Het
Add3 T A 19: 53,226,607 L71Q probably damaging Het
Agbl5 G A 5: 30,893,903 probably null Het
Angpt1 A G 15: 42,512,341 L173P probably damaging Het
BC067074 T C 13: 113,367,893 V1852A probably benign Het
Crls1 T A 2: 132,861,245 M205K possibly damaging Het
Dhtkd1 A T 2: 5,911,851 N671K probably damaging Het
Dmbt1 A T 7: 131,041,190 D246V probably damaging Het
Dolk G A 2: 30,285,808 A75V probably damaging Het
Dtna T A 18: 23,646,230 V623E probably damaging Het
Elavl3 T C 9: 22,036,326 T106A probably benign Het
Ergic1 T C 17: 26,624,678 C41R probably damaging Het
Fat2 T A 11: 55,269,361 I3309F possibly damaging Het
Fbn1 C A 2: 125,365,639 R978L possibly damaging Het
Fzd6 A T 15: 39,031,164 S242C possibly damaging Het
Galntl6 T A 8: 58,472,970 H87L probably benign Het
Gatad2a T C 8: 69,935,941 E32G probably damaging Het
Gemin6 T G 17: 80,227,749 V46G probably damaging Het
Gm11541 G T 11: 94,704,118 H41Q unknown Het
Has3 A G 8: 106,873,947 T14A probably damaging Het
Kmt2b A G 7: 30,580,444 L1377P probably damaging Het
Lcorl T C 5: 45,733,727 N428S probably benign Het
Lipo5 A T 19: 33,467,884 V95D unknown Het
Lrp1 A T 10: 127,555,724 V2942D probably benign Het
Map1a T C 2: 121,305,662 S2082P probably damaging Het
Mast4 T C 13: 102,754,215 S852G possibly damaging Het
Mlh3 A T 12: 85,269,373 L13* probably null Het
Ncam2 C T 16: 81,434,878 R77* probably null Het
Nlrp9c T A 7: 26,382,366 N645I possibly damaging Het
Olfr109 T A 17: 37,467,112 L302Q unknown Het
Olfr1126 T C 2: 87,457,765 I200T probably benign Het
Olfr128 T A 17: 37,924,492 *309K probably null Het
Olfr857 C A 9: 19,713,698 Y290* probably null Het
Pex12 A G 11: 83,296,264 V286A possibly damaging Het
Phax C T 18: 56,584,310 T275I probably damaging Het
Phf21b A G 15: 84,791,805 V335A probably benign Het
Psg18 A T 7: 18,349,348 L173H probably damaging Het
Rab3ip T C 10: 116,918,929 T209A possibly damaging Het
Ralgapb T C 2: 158,432,785 V202A probably damaging Het
Rpn2 T C 2: 157,323,267 L611P probably damaging Het
Runx2 T G 17: 44,724,862 T148P probably damaging Het
Sbpl C A 17: 23,954,649 D50Y probably damaging Het
Scn5a G A 9: 119,521,171 P879L probably damaging Het
Sfn T C 4: 133,601,604 R56G probably damaging Het
Tas2r138 C T 6: 40,612,980 A111T probably benign Het
Tasp1 A T 2: 140,008,789 S105T probably damaging Het
Tmem225 T G 9: 40,150,706 H205Q possibly damaging Het
Tmprss7 A G 16: 45,660,904 S640P probably damaging Het
Utp4 G A 8: 106,917,633 A535T possibly damaging Het
Vmn1r203 A T 13: 22,524,103 D18V probably benign Het
Vmn2r58 A G 7: 41,872,645 L9P probably benign Het
Zcchc2 T A 1: 106,030,254 C420* probably null Het
Zfp804a A G 2: 82,258,590 D921G probably benign Het
Other mutations in Olfr965
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01705:Olfr965 APN 9 39719581 missense possibly damaging 0.95
IGL02365:Olfr965 APN 9 39719674 missense possibly damaging 0.60
IGL02365:Olfr965 APN 9 39720100 missense probably damaging 0.98
IGL03062:Olfr965 APN 9 39720035 missense probably benign 0.26
IGL03330:Olfr965 APN 9 39719488 missense probably benign 0.08
R0011:Olfr965 UTSW 9 39719627 missense probably benign 0.26
R0462:Olfr965 UTSW 9 39719410 missense probably benign 0.01
R1505:Olfr965 UTSW 9 39719478 missense probably damaging 1.00
R1995:Olfr965 UTSW 9 39719413 missense probably damaging 1.00
R2049:Olfr965 UTSW 9 39720115 missense probably damaging 1.00
R2110:Olfr965 UTSW 9 39719722 missense probably benign 0.30
R3817:Olfr965 UTSW 9 39720108 missense possibly damaging 0.95
R4152:Olfr965 UTSW 9 39720000 missense probably benign 0.10
R4153:Olfr965 UTSW 9 39720000 missense probably benign 0.10
R4351:Olfr965 UTSW 9 39719569 missense probably damaging 0.99
R4377:Olfr965 UTSW 9 39719807 missense probably benign 0.04
R4667:Olfr965 UTSW 9 39719709 missense probably benign 0.09
R5816:Olfr965 UTSW 9 39719230 start codon destroyed probably null 1.00
R7113:Olfr965 UTSW 9 39719677 missense probably benign
R7336:Olfr965 UTSW 9 39719610 missense probably benign 0.28
Predicted Primers PCR Primer
(F):5'- AGCAGCCTGTCCTTCATTGAC -3'
(R):5'- CCTCATTGACAAATGTGCTGG -3'

Sequencing Primer
(F):5'- AGCCTGTCCTTCATTGACCTCTG -3'
(R):5'- TTGCAGCAATGGAAGAAGATCAC -3'
Posted On2016-10-05