Incidental Mutation 'R5526:Angpt1'
ID431878
Institutional Source Beutler Lab
Gene Symbol Angpt1
Ensembl Gene ENSMUSG00000022309
Gene Nameangiopoietin 1
SynonymsAngiopoietin-1, 1110046O21Rik, Ang-1, ang1
MMRRC Submission 043084-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5526 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location42424723-42676977 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 42512341 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 173 (L173P)
Ref Sequence ENSEMBL: ENSMUSP00000022921 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022921]
Predicted Effect probably damaging
Transcript: ENSMUST00000022921
AA Change: L173P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000022921
Gene: ENSMUSG00000022309
AA Change: L173P

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
coiled coil region 194 254 N/A INTRINSIC
FBG 281 496 3.04e-132 SMART
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.3%
  • 10x: 95.2%
  • 20x: 90.7%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a secreted glycoprotein that belongs to the angiopoietin family of vascular growth factors. The encoded protein is a ligand in the vascular tyrosine kinase signaling pathway and regulates the formation and stabilization of blood vessels. This protein also functions in striated muscles by promoting proliferation, migration and differentiation of skeletal myoblasts and plays an essential role in the vascular response to tissue injury. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2013]
PHENOTYPE: Mice homozygous for disruptions in this gene display embryonic lethality by E12.5 and deficits in vascular development such as a reduction in vascular branching. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik T C 4: 42,972,125 V486A possibly damaging Het
Abca12 A T 1: 71,292,446 M1315K probably benign Het
Abcc4 C T 14: 118,631,037 V168I probably benign Het
Add3 T A 19: 53,226,607 L71Q probably damaging Het
Agbl5 G A 5: 30,893,903 probably null Het
BC067074 T C 13: 113,367,893 V1852A probably benign Het
Crls1 T A 2: 132,861,245 M205K possibly damaging Het
Dhtkd1 A T 2: 5,911,851 N671K probably damaging Het
Dmbt1 A T 7: 131,041,190 D246V probably damaging Het
Dolk G A 2: 30,285,808 A75V probably damaging Het
Dtna T A 18: 23,646,230 V623E probably damaging Het
Elavl3 T C 9: 22,036,326 T106A probably benign Het
Ergic1 T C 17: 26,624,678 C41R probably damaging Het
Fat2 T A 11: 55,269,361 I3309F possibly damaging Het
Fbn1 C A 2: 125,365,639 R978L possibly damaging Het
Fzd6 A T 15: 39,031,164 S242C possibly damaging Het
Galntl6 T A 8: 58,472,970 H87L probably benign Het
Gatad2a T C 8: 69,935,941 E32G probably damaging Het
Gemin6 T G 17: 80,227,749 V46G probably damaging Het
Gm11541 G T 11: 94,704,118 H41Q unknown Het
Has3 A G 8: 106,873,947 T14A probably damaging Het
Kmt2b A G 7: 30,580,444 L1377P probably damaging Het
Lcorl T C 5: 45,733,727 N428S probably benign Het
Lipo5 A T 19: 33,467,884 V95D unknown Het
Lrp1 A T 10: 127,555,724 V2942D probably benign Het
Map1a T C 2: 121,305,662 S2082P probably damaging Het
Mast4 T C 13: 102,754,215 S852G possibly damaging Het
Mlh3 A T 12: 85,269,373 L13* probably null Het
Ncam2 C T 16: 81,434,878 R77* probably null Het
Nlrp9c T A 7: 26,382,366 N645I possibly damaging Het
Olfr109 T A 17: 37,467,112 L302Q unknown Het
Olfr1126 T C 2: 87,457,765 I200T probably benign Het
Olfr128 T A 17: 37,924,492 *309K probably null Het
Olfr857 C A 9: 19,713,698 Y290* probably null Het
Olfr965 A T 9: 39,719,596 Y123F possibly damaging Het
Pex12 A G 11: 83,296,264 V286A possibly damaging Het
Phax C T 18: 56,584,310 T275I probably damaging Het
Phf21b A G 15: 84,791,805 V335A probably benign Het
Psg18 A T 7: 18,349,348 L173H probably damaging Het
Rab3ip T C 10: 116,918,929 T209A possibly damaging Het
Ralgapb T C 2: 158,432,785 V202A probably damaging Het
Rpn2 T C 2: 157,323,267 L611P probably damaging Het
Runx2 T G 17: 44,724,862 T148P probably damaging Het
Sbpl C A 17: 23,954,649 D50Y probably damaging Het
Scn5a G A 9: 119,521,171 P879L probably damaging Het
Sfn T C 4: 133,601,604 R56G probably damaging Het
Tas2r138 C T 6: 40,612,980 A111T probably benign Het
Tasp1 A T 2: 140,008,789 S105T probably damaging Het
Tmem225 T G 9: 40,150,706 H205Q possibly damaging Het
Tmprss7 A G 16: 45,660,904 S640P probably damaging Het
Utp4 G A 8: 106,917,633 A535T possibly damaging Het
Vmn1r203 A T 13: 22,524,103 D18V probably benign Het
Vmn2r58 A G 7: 41,872,645 L9P probably benign Het
Zcchc2 T A 1: 106,030,254 C420* probably null Het
Zfp804a A G 2: 82,258,590 D921G probably benign Het
Other mutations in Angpt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01761:Angpt1 APN 15 42476467 missense possibly damaging 0.73
IGL02671:Angpt1 APN 15 42676394 missense possibly damaging 0.79
IGL02876:Angpt1 APN 15 42426977 missense possibly damaging 0.68
IGL03077:Angpt1 APN 15 42476422 nonsense probably null
IGL03334:Angpt1 APN 15 42496412 missense possibly damaging 0.94
R0226:Angpt1 UTSW 15 42468235 missense probably benign 0.01
R1774:Angpt1 UTSW 15 42523616 missense probably damaging 0.99
R1800:Angpt1 UTSW 15 42512404 missense probably damaging 0.96
R1967:Angpt1 UTSW 15 42438307 missense probably damaging 1.00
R4093:Angpt1 UTSW 15 42523545 missense probably damaging 1.00
R4477:Angpt1 UTSW 15 42468164 missense probably damaging 1.00
R4629:Angpt1 UTSW 15 42438400 missense probably benign 0.01
R4647:Angpt1 UTSW 15 42676184 missense probably benign 0.02
R4648:Angpt1 UTSW 15 42676184 missense probably benign 0.02
R4750:Angpt1 UTSW 15 42676401 missense probably benign 0.00
R5222:Angpt1 UTSW 15 42676334 missense probably damaging 1.00
R5386:Angpt1 UTSW 15 42438365 missense probably damaging 1.00
R5457:Angpt1 UTSW 15 42523520 missense probably damaging 1.00
R6154:Angpt1 UTSW 15 42523655 missense probably damaging 1.00
R6904:Angpt1 UTSW 15 42459740 missense probably benign 0.00
R7009:Angpt1 UTSW 15 42523595 missense possibly damaging 0.83
R7101:Angpt1 UTSW 15 42523569 missense probably benign 0.18
R7139:Angpt1 UTSW 15 42676351 missense probably damaging 1.00
R7234:Angpt1 UTSW 15 42459725 missense probably benign 0.25
R7830:Angpt1 UTSW 15 42676268 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAACACAGGCCCAATGGTTG -3'
(R):5'- CATCATATGCCTAAGTCATTCGG -3'

Sequencing Primer
(F):5'- CCAATGGTTGACACATTGGC -3'
(R):5'- CTCAAGGATTTTTTGCTACTTG -3'
Posted On2016-10-05