Incidental Mutation 'R5526:Ncam2'
ID431882
Institutional Source Beutler Lab
Gene Symbol Ncam2
Ensembl Gene ENSMUSG00000022762
Gene Nameneural cell adhesion molecule 2
SynonymsOcam, RNCAM, Ncam-2, R4B12 antigen
MMRRC Submission 043084-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5526 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location81200697-81626828 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 81434878 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 77 (R77*)
Ref Sequence ENSEMBL: ENSMUSP00000063468 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037785] [ENSMUST00000067602]
Predicted Effect probably null
Transcript: ENSMUST00000037785
AA Change: R77*
SMART Domains Protein: ENSMUSP00000049390
Gene: ENSMUSG00000022762
AA Change: R77*

DomainStartEndE-ValueType
low complexity region 3 13 N/A INTRINSIC
IGc2 33 100 3.18e-6 SMART
IGc2 127 193 1.13e-11 SMART
IGc2 223 288 2.03e-13 SMART
IGc2 313 387 1.12e-15 SMART
IGc2 413 482 9.93e-8 SMART
FN3 496 578 5.91e-13 SMART
FN3 594 675 2.87e-2 SMART
Predicted Effect probably null
Transcript: ENSMUST00000067602
AA Change: R77*
SMART Domains Protein: ENSMUSP00000063468
Gene: ENSMUSG00000022762
AA Change: R77*

DomainStartEndE-ValueType
low complexity region 3 13 N/A INTRINSIC
IGc2 33 100 3.18e-6 SMART
IGc2 127 193 1.13e-11 SMART
IGc2 223 288 2.03e-13 SMART
IGc2 313 387 1.12e-15 SMART
IGc2 413 482 9.93e-8 SMART
FN3 496 578 5.91e-13 SMART
FN3 594 675 2.87e-2 SMART
transmembrane domain 696 718 N/A INTRINSIC
low complexity region 741 757 N/A INTRINSIC
low complexity region 789 812 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231687
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.3%
  • 10x: 95.2%
  • 20x: 90.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the immunoglobulin superfamily. It is a type I membrane protein and may function in selective fasciculation and zone-to-zone projection of the primary olfactory axons. [provided by RefSeq, Jul 2008]
PHENOTYPE: A gene trap insertion into an intron of this gene results in no obvious phenotype. Mice homozygous for a knock-out allele exhibit exhibit increased proliferation rate and clonogenic frequency in spinal cord-derived neurospheres. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik T C 4: 42,972,125 V486A possibly damaging Het
Abca12 A T 1: 71,292,446 M1315K probably benign Het
Abcc4 C T 14: 118,631,037 V168I probably benign Het
Add3 T A 19: 53,226,607 L71Q probably damaging Het
Agbl5 G A 5: 30,893,903 probably null Het
Angpt1 A G 15: 42,512,341 L173P probably damaging Het
BC067074 T C 13: 113,367,893 V1852A probably benign Het
Crls1 T A 2: 132,861,245 M205K possibly damaging Het
Dhtkd1 A T 2: 5,911,851 N671K probably damaging Het
Dmbt1 A T 7: 131,041,190 D246V probably damaging Het
Dolk G A 2: 30,285,808 A75V probably damaging Het
Dtna T A 18: 23,646,230 V623E probably damaging Het
Elavl3 T C 9: 22,036,326 T106A probably benign Het
Ergic1 T C 17: 26,624,678 C41R probably damaging Het
Fat2 T A 11: 55,269,361 I3309F possibly damaging Het
Fbn1 C A 2: 125,365,639 R978L possibly damaging Het
Fzd6 A T 15: 39,031,164 S242C possibly damaging Het
Galntl6 T A 8: 58,472,970 H87L probably benign Het
Gatad2a T C 8: 69,935,941 E32G probably damaging Het
Gemin6 T G 17: 80,227,749 V46G probably damaging Het
Gm11541 G T 11: 94,704,118 H41Q unknown Het
Has3 A G 8: 106,873,947 T14A probably damaging Het
Kmt2b A G 7: 30,580,444 L1377P probably damaging Het
Lcorl T C 5: 45,733,727 N428S probably benign Het
Lipo5 A T 19: 33,467,884 V95D unknown Het
Lrp1 A T 10: 127,555,724 V2942D probably benign Het
Map1a T C 2: 121,305,662 S2082P probably damaging Het
Mast4 T C 13: 102,754,215 S852G possibly damaging Het
Mlh3 A T 12: 85,269,373 L13* probably null Het
Nlrp9c T A 7: 26,382,366 N645I possibly damaging Het
Olfr109 T A 17: 37,467,112 L302Q unknown Het
Olfr1126 T C 2: 87,457,765 I200T probably benign Het
Olfr128 T A 17: 37,924,492 *309K probably null Het
Olfr857 C A 9: 19,713,698 Y290* probably null Het
Olfr965 A T 9: 39,719,596 Y123F possibly damaging Het
Pex12 A G 11: 83,296,264 V286A possibly damaging Het
Phax C T 18: 56,584,310 T275I probably damaging Het
Phf21b A G 15: 84,791,805 V335A probably benign Het
Psg18 A T 7: 18,349,348 L173H probably damaging Het
Rab3ip T C 10: 116,918,929 T209A possibly damaging Het
Ralgapb T C 2: 158,432,785 V202A probably damaging Het
Rpn2 T C 2: 157,323,267 L611P probably damaging Het
Runx2 T G 17: 44,724,862 T148P probably damaging Het
Sbpl C A 17: 23,954,649 D50Y probably damaging Het
Scn5a G A 9: 119,521,171 P879L probably damaging Het
Sfn T C 4: 133,601,604 R56G probably damaging Het
Tas2r138 C T 6: 40,612,980 A111T probably benign Het
Tasp1 A T 2: 140,008,789 S105T probably damaging Het
Tmem225 T G 9: 40,150,706 H205Q possibly damaging Het
Tmprss7 A G 16: 45,660,904 S640P probably damaging Het
Utp4 G A 8: 106,917,633 A535T possibly damaging Het
Vmn1r203 A T 13: 22,524,103 D18V probably benign Het
Vmn2r58 A G 7: 41,872,645 L9P probably benign Het
Zcchc2 T A 1: 106,030,254 C420* probably null Het
Zfp804a A G 2: 82,258,590 D921G probably benign Het
Other mutations in Ncam2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01138:Ncam2 APN 16 81517579 missense probably damaging 1.00
IGL01369:Ncam2 APN 16 81461571 missense probably benign 0.09
IGL01554:Ncam2 APN 16 81512935 missense possibly damaging 0.88
IGL01892:Ncam2 APN 16 81589699 missense possibly damaging 0.71
IGL02320:Ncam2 APN 16 81434837 missense probably damaging 0.99
IGL02669:Ncam2 APN 16 81517541 missense probably benign 0.18
IGL03073:Ncam2 APN 16 81621347 missense possibly damaging 0.70
IGL03353:Ncam2 APN 16 81434900 missense probably benign 0.04
R0087:Ncam2 UTSW 16 81434901 missense probably benign 0.11
R0097:Ncam2 UTSW 16 81517537 missense probably damaging 1.00
R0276:Ncam2 UTSW 16 81517629 splice site probably benign
R0279:Ncam2 UTSW 16 81623337 splice site probably benign
R0471:Ncam2 UTSW 16 81200884 start gained probably benign
R0523:Ncam2 UTSW 16 81461643 missense probably damaging 0.99
R1353:Ncam2 UTSW 16 81200915 start codon destroyed probably null
R1646:Ncam2 UTSW 16 81465706 critical splice donor site probably benign
R1884:Ncam2 UTSW 16 81437683 missense probably damaging 1.00
R2002:Ncam2 UTSW 16 81589698 missense possibly damaging 0.70
R2157:Ncam2 UTSW 16 81490389 missense probably damaging 1.00
R2330:Ncam2 UTSW 16 81512921 missense probably benign 0.17
R2404:Ncam2 UTSW 16 81490240 splice site probably benign
R2434:Ncam2 UTSW 16 81595225 missense probably benign 0.01
R3104:Ncam2 UTSW 16 81465710 splice site probably benign
R3842:Ncam2 UTSW 16 81434810 missense probably damaging 1.00
R3954:Ncam2 UTSW 16 81589724 missense probably damaging 1.00
R4039:Ncam2 UTSW 16 81490323 missense probably benign 0.02
R4210:Ncam2 UTSW 16 81527103 missense probably benign 0.02
R4514:Ncam2 UTSW 16 81512996 missense probably benign 0.13
R4583:Ncam2 UTSW 16 81517557 missense probably damaging 1.00
R4586:Ncam2 UTSW 16 81465569 missense probably benign 0.06
R4710:Ncam2 UTSW 16 81465706 critical splice donor site probably null
R4732:Ncam2 UTSW 16 81434884 missense possibly damaging 0.63
R4733:Ncam2 UTSW 16 81434884 missense possibly damaging 0.63
R4876:Ncam2 UTSW 16 81490346 missense probably benign 0.27
R4923:Ncam2 UTSW 16 81589791 missense possibly damaging 0.48
R5131:Ncam2 UTSW 16 81437662 missense probably benign 0.44
R5329:Ncam2 UTSW 16 81434819 missense probably damaging 1.00
R5478:Ncam2 UTSW 16 81434878 nonsense probably null
R5479:Ncam2 UTSW 16 81434878 nonsense probably null
R5481:Ncam2 UTSW 16 81434878 nonsense probably null
R5519:Ncam2 UTSW 16 81434878 nonsense probably null
R5522:Ncam2 UTSW 16 81434878 nonsense probably null
R5523:Ncam2 UTSW 16 81434878 nonsense probably null
R5524:Ncam2 UTSW 16 81434878 nonsense probably null
R5718:Ncam2 UTSW 16 81589814 splice site probably null
R5793:Ncam2 UTSW 16 81576103 missense possibly damaging 0.95
R6050:Ncam2 UTSW 16 81443166 nonsense probably null
R6212:Ncam2 UTSW 16 81432762 missense probably damaging 1.00
R6847:Ncam2 UTSW 16 81432718 missense probably damaging 1.00
R6935:Ncam2 UTSW 16 81526991 missense probably benign 0.24
R7159:Ncam2 UTSW 16 81490374 missense probably damaging 1.00
R7193:Ncam2 UTSW 16 81589795 missense probably damaging 1.00
R7232:Ncam2 UTSW 16 81512871 missense probably damaging 1.00
R7346:Ncam2 UTSW 16 81623368 missense probably damaging 1.00
R7568:Ncam2 UTSW 16 81589801 missense probably benign 0.19
R7686:Ncam2 UTSW 16 81621454 missense probably damaging 0.99
R7759:Ncam2 UTSW 16 81615784 missense probably damaging 1.00
R7848:Ncam2 UTSW 16 81490379 missense probably benign
R7931:Ncam2 UTSW 16 81490379 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGTTTCAGATCTCCAGGCTTCTG -3'
(R):5'- GTGTTTGAGTCCTTCCTGATGAAAC -3'

Sequencing Primer
(F):5'- AGATCTCCAGGCTTCTGTTTACAC -3'
(R):5'- GAAACTGCTGTGTCAATGACC -3'
Posted On2016-10-05