Incidental Mutation 'R5526:Olfr109'
ID431885
Institutional Source Beutler Lab
Gene Symbol Olfr109
Ensembl Gene ENSMUSG00000029184
Gene Nameolfactory receptor 109
SynonymsGA_x6K02T2PSCP-1914078-1915022, MOR250-1
MMRRC Submission 043084-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.078) question?
Stock #R5526 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location37458916-37471590 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 37467112 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 302 (L302Q)
Ref Sequence ENSEMBL: ENSMUSP00000150044 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031086] [ENSMUST00000214668] [ENSMUST00000214938] [ENSMUST00000217602]
Predicted Effect unknown
Transcript: ENSMUST00000031086
AA Change: L302Q
SMART Domains Protein: ENSMUSP00000031086
Gene: ENSMUSG00000029184
AA Change: L302Q

DomainStartEndE-ValueType
Pfam:7tm_4 29 309 3.4e-54 PFAM
Pfam:7tm_1 39 291 6.3e-23 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000214668
AA Change: L302Q
Predicted Effect unknown
Transcript: ENSMUST00000214938
AA Change: L302Q
Predicted Effect unknown
Transcript: ENSMUST00000217602
AA Change: L302Q
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.3%
  • 10x: 95.2%
  • 20x: 90.7%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik T C 4: 42,972,125 V486A possibly damaging Het
Abca12 A T 1: 71,292,446 M1315K probably benign Het
Abcc4 C T 14: 118,631,037 V168I probably benign Het
Add3 T A 19: 53,226,607 L71Q probably damaging Het
Agbl5 G A 5: 30,893,903 probably null Het
Angpt1 A G 15: 42,512,341 L173P probably damaging Het
BC067074 T C 13: 113,367,893 V1852A probably benign Het
Crls1 T A 2: 132,861,245 M205K possibly damaging Het
Dhtkd1 A T 2: 5,911,851 N671K probably damaging Het
Dmbt1 A T 7: 131,041,190 D246V probably damaging Het
Dolk G A 2: 30,285,808 A75V probably damaging Het
Dtna T A 18: 23,646,230 V623E probably damaging Het
Elavl3 T C 9: 22,036,326 T106A probably benign Het
Ergic1 T C 17: 26,624,678 C41R probably damaging Het
Fat2 T A 11: 55,269,361 I3309F possibly damaging Het
Fbn1 C A 2: 125,365,639 R978L possibly damaging Het
Fzd6 A T 15: 39,031,164 S242C possibly damaging Het
Galntl6 T A 8: 58,472,970 H87L probably benign Het
Gatad2a T C 8: 69,935,941 E32G probably damaging Het
Gemin6 T G 17: 80,227,749 V46G probably damaging Het
Gm11541 G T 11: 94,704,118 H41Q unknown Het
Has3 A G 8: 106,873,947 T14A probably damaging Het
Kmt2b A G 7: 30,580,444 L1377P probably damaging Het
Lcorl T C 5: 45,733,727 N428S probably benign Het
Lipo5 A T 19: 33,467,884 V95D unknown Het
Lrp1 A T 10: 127,555,724 V2942D probably benign Het
Map1a T C 2: 121,305,662 S2082P probably damaging Het
Mast4 T C 13: 102,754,215 S852G possibly damaging Het
Mlh3 A T 12: 85,269,373 L13* probably null Het
Ncam2 C T 16: 81,434,878 R77* probably null Het
Nlrp9c T A 7: 26,382,366 N645I possibly damaging Het
Olfr1126 T C 2: 87,457,765 I200T probably benign Het
Olfr128 T A 17: 37,924,492 *309K probably null Het
Olfr857 C A 9: 19,713,698 Y290* probably null Het
Olfr965 A T 9: 39,719,596 Y123F possibly damaging Het
Pex12 A G 11: 83,296,264 V286A possibly damaging Het
Phax C T 18: 56,584,310 T275I probably damaging Het
Phf21b A G 15: 84,791,805 V335A probably benign Het
Psg18 A T 7: 18,349,348 L173H probably damaging Het
Rab3ip T C 10: 116,918,929 T209A possibly damaging Het
Ralgapb T C 2: 158,432,785 V202A probably damaging Het
Rpn2 T C 2: 157,323,267 L611P probably damaging Het
Runx2 T G 17: 44,724,862 T148P probably damaging Het
Sbpl C A 17: 23,954,649 D50Y probably damaging Het
Scn5a G A 9: 119,521,171 P879L probably damaging Het
Sfn T C 4: 133,601,604 R56G probably damaging Het
Tas2r138 C T 6: 40,612,980 A111T probably benign Het
Tasp1 A T 2: 140,008,789 S105T probably damaging Het
Tmem225 T G 9: 40,150,706 H205Q possibly damaging Het
Tmprss7 A G 16: 45,660,904 S640P probably damaging Het
Utp4 G A 8: 106,917,633 A535T possibly damaging Het
Vmn1r203 A T 13: 22,524,103 D18V probably benign Het
Vmn2r58 A G 7: 41,872,645 L9P probably benign Het
Zcchc2 T A 1: 106,030,254 C420* probably null Het
Zfp804a A G 2: 82,258,590 D921G probably benign Het
Other mutations in Olfr109
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01813:Olfr109 APN 17 37466758 missense probably damaging 1.00
IGL02039:Olfr109 APN 17 37466449 missense possibly damaging 0.49
IGL02391:Olfr109 APN 17 37466586 missense probably damaging 1.00
IGL02730:Olfr109 APN 17 37466859 missense probably damaging 1.00
IGL02751:Olfr109 APN 17 37466415 missense probably damaging 0.98
IGL02891:Olfr109 APN 17 37466944 missense probably damaging 1.00
IGL03023:Olfr109 APN 17 37466994 missense probably benign
IGL03343:Olfr109 APN 17 37466409 missense probably damaging 1.00
R0026:Olfr109 UTSW 17 37466803 missense probably damaging 0.99
R0579:Olfr109 UTSW 17 37466347 missense probably benign 0.01
R1751:Olfr109 UTSW 17 37466901 missense probably benign 0.00
R1848:Olfr109 UTSW 17 37467047 missense probably damaging 0.99
R2392:Olfr109 UTSW 17 37466419 missense probably damaging 1.00
R4249:Olfr109 UTSW 17 37466824 missense probably damaging 0.98
R4464:Olfr109 UTSW 17 37466851 missense probably damaging 1.00
R4857:Olfr109 UTSW 17 37466823 missense possibly damaging 0.80
R4947:Olfr109 UTSW 17 37466743 missense probably damaging 1.00
R5107:Olfr109 UTSW 17 37466253 missense probably damaging 0.97
R6147:Olfr109 UTSW 17 37466539 missense probably benign 0.00
R6416:Olfr109 UTSW 17 37467080 nonsense probably null
R7450:Olfr109 UTSW 17 37466616 missense probably benign 0.00
R7487:Olfr109 UTSW 17 37466566 missense probably damaging 0.96
R7822:Olfr109 UTSW 17 37467103 missense probably benign 0.00
R8041:Olfr109 UTSW 17 37466649 missense not run
R8051:Olfr109 UTSW 17 37466322 missense not run
X0063:Olfr109 UTSW 17 37466524 missense probably damaging 1.00
X0065:Olfr109 UTSW 17 37466318 missense probably damaging 1.00
Z1176:Olfr109 UTSW 17 37466661 missense not run
Predicted Primers PCR Primer
(F):5'- TGCAGAATGCTTAAGAAGGCTCTG -3'
(R):5'- TCCCATGAAACTTGAACTTTCTGTC -3'

Sequencing Primer
(F):5'- AAGAAGGCTCTGTCTACCTGC -3'
(R):5'- ATGAAACTTGAACTTTCTGTCTTGCC -3'
Posted On2016-10-05