Incidental Mutation 'R5526:Gemin6'
ID431888
Institutional Source Beutler Lab
Gene Symbol Gemin6
Ensembl Gene ENSMUSG00000055760
Gene Namegem nuclear organelle associated protein 6
Synonyms
MMRRC Submission 043084-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.796) question?
Stock #R5526 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location80224441-80228497 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 80227749 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glycine at position 46 (V46G)
Ref Sequence ENSEMBL: ENSMUSP00000063554 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069486]
Predicted Effect probably damaging
Transcript: ENSMUST00000069486
AA Change: V46G

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000063554
Gene: ENSMUSG00000055760
AA Change: V46G

DomainStartEndE-ValueType
Pfam:Gemin6 1 166 9.7e-102 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156869
Meta Mutation Damage Score 0.4198 question?
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.3%
  • 10x: 95.2%
  • 20x: 90.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik T C 4: 42,972,125 V486A possibly damaging Het
Abca12 A T 1: 71,292,446 M1315K probably benign Het
Abcc4 C T 14: 118,631,037 V168I probably benign Het
Add3 T A 19: 53,226,607 L71Q probably damaging Het
Agbl5 G A 5: 30,893,903 probably null Het
Angpt1 A G 15: 42,512,341 L173P probably damaging Het
BC067074 T C 13: 113,367,893 V1852A probably benign Het
Crls1 T A 2: 132,861,245 M205K possibly damaging Het
Dhtkd1 A T 2: 5,911,851 N671K probably damaging Het
Dmbt1 A T 7: 131,041,190 D246V probably damaging Het
Dolk G A 2: 30,285,808 A75V probably damaging Het
Dtna T A 18: 23,646,230 V623E probably damaging Het
Elavl3 T C 9: 22,036,326 T106A probably benign Het
Ergic1 T C 17: 26,624,678 C41R probably damaging Het
Fat2 T A 11: 55,269,361 I3309F possibly damaging Het
Fbn1 C A 2: 125,365,639 R978L possibly damaging Het
Fzd6 A T 15: 39,031,164 S242C possibly damaging Het
Galntl6 T A 8: 58,472,970 H87L probably benign Het
Gatad2a T C 8: 69,935,941 E32G probably damaging Het
Gm11541 G T 11: 94,704,118 H41Q unknown Het
Has3 A G 8: 106,873,947 T14A probably damaging Het
Kmt2b A G 7: 30,580,444 L1377P probably damaging Het
Lcorl T C 5: 45,733,727 N428S probably benign Het
Lipo5 A T 19: 33,467,884 V95D unknown Het
Lrp1 A T 10: 127,555,724 V2942D probably benign Het
Map1a T C 2: 121,305,662 S2082P probably damaging Het
Mast4 T C 13: 102,754,215 S852G possibly damaging Het
Mlh3 A T 12: 85,269,373 L13* probably null Het
Ncam2 C T 16: 81,434,878 R77* probably null Het
Nlrp9c T A 7: 26,382,366 N645I possibly damaging Het
Olfr109 T A 17: 37,467,112 L302Q unknown Het
Olfr1126 T C 2: 87,457,765 I200T probably benign Het
Olfr128 T A 17: 37,924,492 *309K probably null Het
Olfr857 C A 9: 19,713,698 Y290* probably null Het
Olfr965 A T 9: 39,719,596 Y123F possibly damaging Het
Pex12 A G 11: 83,296,264 V286A possibly damaging Het
Phax C T 18: 56,584,310 T275I probably damaging Het
Phf21b A G 15: 84,791,805 V335A probably benign Het
Psg18 A T 7: 18,349,348 L173H probably damaging Het
Rab3ip T C 10: 116,918,929 T209A possibly damaging Het
Ralgapb T C 2: 158,432,785 V202A probably damaging Het
Rpn2 T C 2: 157,323,267 L611P probably damaging Het
Runx2 T G 17: 44,724,862 T148P probably damaging Het
Sbpl C A 17: 23,954,649 D50Y probably damaging Het
Scn5a G A 9: 119,521,171 P879L probably damaging Het
Sfn T C 4: 133,601,604 R56G probably damaging Het
Tas2r138 C T 6: 40,612,980 A111T probably benign Het
Tasp1 A T 2: 140,008,789 S105T probably damaging Het
Tmem225 T G 9: 40,150,706 H205Q possibly damaging Het
Tmprss7 A G 16: 45,660,904 S640P probably damaging Het
Utp4 G A 8: 106,917,633 A535T possibly damaging Het
Vmn1r203 A T 13: 22,524,103 D18V probably benign Het
Vmn2r58 A G 7: 41,872,645 L9P probably benign Het
Zcchc2 T A 1: 106,030,254 C420* probably null Het
Zfp804a A G 2: 82,258,590 D921G probably benign Het
Other mutations in Gemin6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00953:Gemin6 APN 17 80227865 missense possibly damaging 0.56
IGL02129:Gemin6 APN 17 80227926 missense probably damaging 1.00
R0197:Gemin6 UTSW 17 80228095 missense probably damaging 1.00
R0239:Gemin6 UTSW 17 80225710 missense probably damaging 1.00
R0239:Gemin6 UTSW 17 80225710 missense probably damaging 1.00
R0883:Gemin6 UTSW 17 80228095 missense probably damaging 1.00
R1995:Gemin6 UTSW 17 80227985 missense probably damaging 1.00
R4570:Gemin6 UTSW 17 80228069 nonsense probably null
R4885:Gemin6 UTSW 17 80227898 missense probably damaging 0.99
R5335:Gemin6 UTSW 17 80225755 missense probably damaging 1.00
R5445:Gemin6 UTSW 17 80227749 missense probably damaging 0.98
R5447:Gemin6 UTSW 17 80227749 missense probably damaging 0.98
R5451:Gemin6 UTSW 17 80227749 missense probably damaging 0.98
R5452:Gemin6 UTSW 17 80227749 missense probably damaging 0.98
R5522:Gemin6 UTSW 17 80227749 missense probably damaging 0.98
R5525:Gemin6 UTSW 17 80227749 missense probably damaging 0.98
R7291:Gemin6 UTSW 17 80227775 missense possibly damaging 0.61
R7576:Gemin6 UTSW 17 80225726 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CCACATTTAAGACAGATGGCCTAATTC -3'
(R):5'- CCATTTCTTGAGGCTGGTCC -3'

Sequencing Primer
(F):5'- AGGGGCCAAGCTTTTAATCC -3'
(R):5'- GGCTGGTCCTCTTCTCTTCCAG -3'
Posted On2016-10-05