Incidental Mutation 'R5526:Dtna'
ID431889
Institutional Source Beutler Lab
Gene Symbol Dtna
Ensembl Gene ENSMUSG00000024302
Gene Namedystrobrevin alpha
Synonymsalpha-dystrobrevin, adbn, Dtn, a-DB-1, A0, 87K protein, 2210407P21Rik
MMRRC Submission 043084-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.187) question?
Stock #R5526 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location23415135-23659715 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 23646230 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 623 (V623E)
Ref Sequence ENSEMBL: ENSMUSP00000152288 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115832] [ENSMUST00000220904]
Predicted Effect probably damaging
Transcript: ENSMUST00000115832
AA Change: V559E

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000111498
Gene: ENSMUSG00000024302
AA Change: V559E

DomainStartEndE-ValueType
Pfam:EF-hand_2 16 140 1.7e-37 PFAM
Pfam:EF-hand_3 144 232 1.6e-32 PFAM
ZnF_ZZ 237 282 1.29e-17 SMART
SCOP:d1eq1a_ 361 494 5e-3 SMART
low complexity region 499 514 N/A INTRINSIC
coiled coil region 650 677 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220789
Predicted Effect probably damaging
Transcript: ENSMUST00000220904
AA Change: V623E

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.3%
  • 10x: 95.2%
  • 20x: 90.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the dystrobrevin subfamily of the dystrophin family. This protein is a component of the dystrophin-associated protein complex (DPC), which consists of dystrophin and several integral and peripheral membrane proteins, including dystroglycans, sarcoglycans, syntrophins and alpha- and beta-dystrobrevin. The DPC localizes to the sarcolemma and its disruption is associated with various forms of muscular dystrophy. Mutations in this gene are associated with left ventricular noncompaction with congenital heart defects. Multiple alternatively spliced transcript variants encoding different isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous targeted mutants exhibit skeletal and cardiac myopathies. Neuromuscular junctions appear to form normally, but their postnatal maturation is compromised. Dtna mutations do not increase the severity of Dmd or Utrn mutants whose products are also part of the dystrophin-glycoprotein complex. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700022I11Rik T C 4: 42,972,125 V486A possibly damaging Het
Abca12 A T 1: 71,292,446 M1315K probably benign Het
Abcc4 C T 14: 118,631,037 V168I probably benign Het
Add3 T A 19: 53,226,607 L71Q probably damaging Het
Agbl5 G A 5: 30,893,903 probably null Het
Angpt1 A G 15: 42,512,341 L173P probably damaging Het
BC067074 T C 13: 113,367,893 V1852A probably benign Het
Crls1 T A 2: 132,861,245 M205K possibly damaging Het
Dhtkd1 A T 2: 5,911,851 N671K probably damaging Het
Dmbt1 A T 7: 131,041,190 D246V probably damaging Het
Dolk G A 2: 30,285,808 A75V probably damaging Het
Elavl3 T C 9: 22,036,326 T106A probably benign Het
Ergic1 T C 17: 26,624,678 C41R probably damaging Het
Fat2 T A 11: 55,269,361 I3309F possibly damaging Het
Fbn1 C A 2: 125,365,639 R978L possibly damaging Het
Fzd6 A T 15: 39,031,164 S242C possibly damaging Het
Galntl6 T A 8: 58,472,970 H87L probably benign Het
Gatad2a T C 8: 69,935,941 E32G probably damaging Het
Gemin6 T G 17: 80,227,749 V46G probably damaging Het
Gm11541 G T 11: 94,704,118 H41Q unknown Het
Has3 A G 8: 106,873,947 T14A probably damaging Het
Kmt2b A G 7: 30,580,444 L1377P probably damaging Het
Lcorl T C 5: 45,733,727 N428S probably benign Het
Lipo5 A T 19: 33,467,884 V95D unknown Het
Lrp1 A T 10: 127,555,724 V2942D probably benign Het
Map1a T C 2: 121,305,662 S2082P probably damaging Het
Mast4 T C 13: 102,754,215 S852G possibly damaging Het
Mlh3 A T 12: 85,269,373 L13* probably null Het
Ncam2 C T 16: 81,434,878 R77* probably null Het
Nlrp9c T A 7: 26,382,366 N645I possibly damaging Het
Olfr109 T A 17: 37,467,112 L302Q unknown Het
Olfr1126 T C 2: 87,457,765 I200T probably benign Het
Olfr128 T A 17: 37,924,492 *309K probably null Het
Olfr857 C A 9: 19,713,698 Y290* probably null Het
Olfr965 A T 9: 39,719,596 Y123F possibly damaging Het
Pex12 A G 11: 83,296,264 V286A possibly damaging Het
Phax C T 18: 56,584,310 T275I probably damaging Het
Phf21b A G 15: 84,791,805 V335A probably benign Het
Psg18 A T 7: 18,349,348 L173H probably damaging Het
Rab3ip T C 10: 116,918,929 T209A possibly damaging Het
Ralgapb T C 2: 158,432,785 V202A probably damaging Het
Rpn2 T C 2: 157,323,267 L611P probably damaging Het
Runx2 T G 17: 44,724,862 T148P probably damaging Het
Sbpl C A 17: 23,954,649 D50Y probably damaging Het
Scn5a G A 9: 119,521,171 P879L probably damaging Het
Sfn T C 4: 133,601,604 R56G probably damaging Het
Tas2r138 C T 6: 40,612,980 A111T probably benign Het
Tasp1 A T 2: 140,008,789 S105T probably damaging Het
Tmem225 T G 9: 40,150,706 H205Q possibly damaging Het
Tmprss7 A G 16: 45,660,904 S640P probably damaging Het
Utp4 G A 8: 106,917,633 A535T possibly damaging Het
Vmn1r203 A T 13: 22,524,103 D18V probably benign Het
Vmn2r58 A G 7: 41,872,645 L9P probably benign Het
Zcchc2 T A 1: 106,030,254 C420* probably null Het
Zfp804a A G 2: 82,258,590 D921G probably benign Het
Other mutations in Dtna
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00836:Dtna APN 18 23597488 missense probably benign 0.22
IGL01620:Dtna APN 18 23625087 missense probably damaging 1.00
IGL01705:Dtna APN 18 23545731 missense probably damaging 1.00
IGL01914:Dtna APN 18 23597459 missense possibly damaging 0.62
IGL02388:Dtna APN 18 23597514 missense probably benign 0.00
IGL02427:Dtna APN 18 23651538 missense possibly damaging 0.95
IGL03074:Dtna APN 18 23602605 missense possibly damaging 0.74
R0041:Dtna UTSW 18 23646875 unclassified probably benign
R0041:Dtna UTSW 18 23646875 unclassified probably benign
R0078:Dtna UTSW 18 23621442 missense probably damaging 1.00
R0390:Dtna UTSW 18 23597501 missense probably damaging 1.00
R1808:Dtna UTSW 18 23569640 missense probably damaging 1.00
R1872:Dtna UTSW 18 23597560 critical splice donor site probably null
R2095:Dtna UTSW 18 23569748 missense probably damaging 1.00
R2216:Dtna UTSW 18 23569565 missense probably damaging 1.00
R2295:Dtna UTSW 18 23631412 missense probably damaging 1.00
R2402:Dtna UTSW 18 23595478 nonsense probably null
R2846:Dtna UTSW 18 23651503 splice site probably null
R3836:Dtna UTSW 18 23625102 missense probably damaging 1.00
R4764:Dtna UTSW 18 23535149 splice site probably null
R4893:Dtna UTSW 18 23569667 missense probably damaging 0.99
R5194:Dtna UTSW 18 23590245 nonsense probably null
R5373:Dtna UTSW 18 23651613 missense probably damaging 1.00
R5374:Dtna UTSW 18 23651613 missense probably damaging 1.00
R5755:Dtna UTSW 18 23621463 missense probably benign
R5769:Dtna UTSW 18 23651554 missense probably benign 0.27
R6062:Dtna UTSW 18 23622056 missense possibly damaging 0.87
R6413:Dtna UTSW 18 23622014 missense probably damaging 1.00
R6876:Dtna UTSW 18 23611110 missense probably benign 0.00
R7103:Dtna UTSW 18 23653379 critical splice donor site probably null
R7711:Dtna UTSW 18 23625196 critical splice donor site probably null
R7804:Dtna UTSW 18 23595609 missense probably damaging 0.97
R8156:Dtna UTSW 18 23590331 nonsense probably null
R8437:Dtna UTSW 18 23590341 nonsense probably null
R8786:Dtna UTSW 18 23583133 missense not run
X0063:Dtna UTSW 18 23643168 missense probably damaging 0.98
X0066:Dtna UTSW 18 23592981 missense probably benign 0.38
Predicted Primers PCR Primer
(F):5'- GTGCCAGGTCACCATGCTTTAG -3'
(R):5'- CCCTTTCTATTTGACTATGACCAAG -3'

Sequencing Primer
(F):5'- TTTACATCAGGGCCAGTGTAC -3'
(R):5'- TTGACTATGACCAAGTCTCCAAGAGG -3'
Posted On2016-10-05