Incidental Mutation 'R0478:Lbp'
ID43189
Institutional Source Beutler Lab
Gene Symbol Lbp
Ensembl Gene ENSMUSG00000016024
Gene Namelipopolysaccharide binding protein
SynonymsBpifd2
MMRRC Submission 038678-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0478 (G1)
Quality Score221
Status Validated
Chromosome2
Chromosomal Location158306493-158332852 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 158317528 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000016168]
Predicted Effect probably benign
Transcript: ENSMUST00000016168
SMART Domains Protein: ENSMUSP00000016168
Gene: ENSMUSG00000016024

DomainStartEndE-ValueType
low complexity region 4 19 N/A INTRINSIC
BPI1 33 256 1.6e-88 SMART
BPI2 271 474 4.59e-89 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000129811
SMART Domains Protein: ENSMUSP00000118297
Gene: ENSMUSG00000016024

DomainStartEndE-ValueType
SCOP:d1ewfa1 2 48 1e-15 SMART
Pfam:LBP_BPI_CETP_C 49 139 2.9e-35 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146600
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152541
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.0%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 100% (49/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is involved in the acute-phase immunologic response to gram-negative bacterial infections. Gram-negative bacteria contain a glycolipid, lipopolysaccharide (LPS), on their outer cell wall. Together with bactericidal permeability-increasing protein (BPI), the encoded protein binds LPS and interacts with the CD14 receptor, probably playing a role in regulating LPS-dependent monocyte responses. Studies in mice suggest that the encoded protein is necessary for the rapid acute-phase response to LPS but not for the clearance of LPS from circulation. This protein is part of a family of structurally and functionally related proteins, including BPI, plasma cholesteryl ester transfer protein (CETP), and phospholipid transfer protein (PLTP). [provided by RefSeq, Apr 2012]
PHENOTYPE: Homozygous mice have a generally normal phenotype but have an increased sensitivity to infection by gram negative bacteria. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432E11Rik A T 7: 29,562,589 noncoding transcript Het
4930556J24Rik T G 11: 3,976,259 probably benign Het
Acnat1 T G 4: 49,450,901 D70A probably damaging Het
Adnp2 A G 18: 80,129,334 V620A probably benign Het
Aldoart1 T A 4: 72,852,343 H21L probably benign Het
Birc3 A G 9: 7,860,347 V290A probably damaging Het
Bpifb3 C T 2: 153,931,480 probably benign Het
Camta1 C A 4: 151,075,140 R1614L probably damaging Het
Clmn A G 12: 104,785,491 M235T probably damaging Het
Dmbt1 A G 7: 131,041,187 E245G possibly damaging Het
Epgn G T 5: 91,031,128 V36L probably benign Het
Ets2 C A 16: 95,716,262 P346Q probably damaging Het
Fam222b T C 11: 78,153,856 L81P probably damaging Het
Fancf A C 7: 51,861,692 L188R probably damaging Het
Fibin T C 2: 110,362,734 D21G possibly damaging Het
Fzd6 A G 15: 39,034,034 probably null Het
Gbp4 T A 5: 105,119,433 Q540L probably benign Het
Greb1l T A 18: 10,509,281 L531Q probably damaging Het
Il5ra A G 6: 106,738,462 V137A probably benign Het
Kif26a G A 12: 112,175,789 A826T probably damaging Het
Kiz T C 2: 146,942,158 V537A possibly damaging Het
Klhl32 C T 4: 24,792,777 G15D probably damaging Het
Kmt2d G A 15: 98,853,581 probably benign Het
Mmp25 T C 17: 23,632,782 T318A probably benign Het
Mrpl50 A G 4: 49,514,513 C53R probably damaging Het
Msl3l2 G C 10: 56,115,315 E45D probably damaging Het
Nfxl1 A G 5: 72,524,645 probably null Het
Noc3l A G 19: 38,810,006 probably null Het
Olfr1126 T A 2: 87,458,026 V287E probably damaging Het
Olfr1375 T C 11: 51,048,712 S202P probably benign Het
Pgm5 A T 19: 24,834,869 S100T possibly damaging Het
Pi4ka C T 16: 17,309,311 G1093S possibly damaging Het
Pitrm1 T A 13: 6,559,395 S350T probably damaging Het
Ptk2b G T 14: 66,213,372 N48K probably damaging Het
Sept3 T C 15: 82,290,806 L172P probably damaging Het
Sirt3 A T 7: 140,878,114 C41S probably benign Het
Sphkap C T 1: 83,278,711 R152H probably damaging Het
St3gal1 T C 15: 67,113,730 Y25C probably damaging Het
Tbc1d31 T C 15: 57,932,536 F175S probably damaging Het
Tfdp2 T A 9: 96,290,583 D43E probably benign Het
Tgm1 G A 14: 55,700,334 Q773* probably null Het
Tmc3 A T 7: 83,622,152 R837S possibly damaging Het
Unc13a A G 8: 71,651,148 V880A possibly damaging Het
Vmn1r237 T A 17: 21,314,819 V268E probably damaging Het
Zan C T 5: 137,400,526 probably benign Het
Zfp760 G T 17: 21,722,014 E57* probably null Het
Other mutations in Lbp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01609:Lbp APN 2 158328412 missense probably damaging 1.00
IGL01885:Lbp APN 2 158324573 missense probably damaging 1.00
IGL02224:Lbp APN 2 158306749 missense probably damaging 1.00
R0144:Lbp UTSW 2 158319710 missense probably damaging 1.00
R1479:Lbp UTSW 2 158319714 missense probably damaging 1.00
R1569:Lbp UTSW 2 158319687 missense probably damaging 1.00
R2061:Lbp UTSW 2 158324579 missense probably benign 0.28
R4058:Lbp UTSW 2 158324630 missense probably damaging 1.00
R4854:Lbp UTSW 2 158327518 missense possibly damaging 0.58
R5027:Lbp UTSW 2 158308726 missense possibly damaging 0.61
R5749:Lbp UTSW 2 158319753 missense probably damaging 1.00
R5910:Lbp UTSW 2 158324557 missense probably benign 0.02
R6135:Lbp UTSW 2 158317549 missense probably benign 0.09
R6650:Lbp UTSW 2 158309667 missense probably benign 0.36
Z1176:Lbp UTSW 2 158325762 missense probably damaging 1.00
Z1177:Lbp UTSW 2 158320306 missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- TCTCCTCAGACCCTGTTGGAATGC -3'
(R):5'- TTGACTATGTGCGGGACCTGGAAC -3'

Sequencing Primer
(F):5'- CAGACCCTGTTGGAATGCATATC -3'
(R):5'- GCCTATACTGTGTATCAACTGAGAGG -3'
Posted On2013-05-23