Mutagenetix > Incidental Mutations

Incidental Mutation 'R5527:Ubr4'

431909

Institutional Source

Beutler Lab

Gene Symbol

Ubr4

Ensembl Gene

ENSMUSG00000066036

Gene Name

ubiquitin protein ligase E3 component n-recognin 4

Synonyms

LOC381562, D930005K06Rik, Zubr1, p600, 1810009A16Rik, A930005E13Rik

MMRRC Submission

043085-MU

Accession Numbers

Ncbi RefSeq: NM_001160319.1; MGI:1916366

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R5527 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

139352609-139489588 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 139480788 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Asparagine at position 4960 (I4960N)

Ref Sequence

ENSEMBL: ENSMUSP00000125800 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000097822] [ENSMUST00000165860]

Predicted Effect

unknown
Transcript: ENSMUST00000097822
AA Change: I4984N

SMART Domains

Protein: ENSMUSP00000095433
Gene: ENSMUSG00000066036
AA Change: I4984N

Domain	Start	End	E-Value	Type
low complexity region	5	20	N/A	INTRINSIC
low complexity region	414	425	N/A	INTRINSIC
low complexity region	530	541	N/A	INTRINSIC
low complexity region	555	566	N/A	INTRINSIC
low complexity region	571	588	N/A	INTRINSIC
low complexity region	600	621	N/A	INTRINSIC
low complexity region	1312	1330	N/A	INTRINSIC
low complexity region	1642	1655	N/A	INTRINSIC
Pfam:zf-UBR	1660	1725	1.9e-9	PFAM
Blast:ZnF_C2H2	1966	1991	6e-8	BLAST
low complexity region	2268	2279	N/A	INTRINSIC
low complexity region	2502	2540	N/A	INTRINSIC
low complexity region	2725	2735	N/A	INTRINSIC
low complexity region	2818	2852	N/A	INTRINSIC
low complexity region	2887	2905	N/A	INTRINSIC
low complexity region	2928	2942	N/A	INTRINSIC
low complexity region	2945	2959	N/A	INTRINSIC
low complexity region	2966	2986	N/A	INTRINSIC
low complexity region	3063	3091	N/A	INTRINSIC
low complexity region	3329	3385	N/A	INTRINSIC
low complexity region	3776	3788	N/A	INTRINSIC
Pfam:E3_UbLigase_R4	4364	5160	N/A	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000135534

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000141327

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000145273

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000145659

Predicted Effect

possibly damaging
Transcript: ENSMUST00000165860
AA Change: I4960N

PolyPhen 2 Score 0.827 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000125800
Gene: ENSMUSG00000066036
AA Change: I4960N

Domain	Start	End	E-Value	Type
low complexity region	5	20	N/A	INTRINSIC
low complexity region	414	425	N/A	INTRINSIC
low complexity region	530	541	N/A	INTRINSIC
low complexity region	555	566	N/A	INTRINSIC
low complexity region	571	588	N/A	INTRINSIC
low complexity region	600	621	N/A	INTRINSIC
low complexity region	1312	1330	N/A	INTRINSIC
low complexity region	1642	1655	N/A	INTRINSIC
Pfam:zf-UBR	1659	1729	4e-13	PFAM
Blast:ZnF_C2H2	1966	1991	5e-8	BLAST
low complexity region	2268	2279	N/A	INTRINSIC
low complexity region	2513	2551	N/A	INTRINSIC
low complexity region	2736	2746	N/A	INTRINSIC
low complexity region	2863	2881	N/A	INTRINSIC
low complexity region	2904	2918	N/A	INTRINSIC
low complexity region	2921	2935	N/A	INTRINSIC
low complexity region	2942	2962	N/A	INTRINSIC
low complexity region	3039	3067	N/A	INTRINSIC
low complexity region	3305	3361	N/A	INTRINSIC
low complexity region	3752	3764	N/A	INTRINSIC
Pfam:E3_UbLigase_R4	4340	5136	N/A	PFAM

Coding Region Coverage

1x: 98.2%
3x: 97.2%
10x: 94.9%
20x: 89.7%

Validation Efficiency

MGI Phenotype

Strain: 5286698
Lethality: D1-D5
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an E3 ubiquitin-protein ligase that interacts with the retinoblastoma-associated protein in the nucleus and with calcium-bound calmodulin in the cytoplasm. The encoded protein appears to be a cytoskeletal component in the cytoplasm and part of the chromatin scaffold in the nucleus. In addition, this protein is a target of the human papillomavirus type 16 E7 oncoprotein. [provided by RefSeq, Aug 2010]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit neonatal lethality and decreased body size at birth. Mice homozygous for a null mutation display complete embryonic lethality during organogenesis with arrest of vitelline vascular remodeling. [provided by MGI curators]

Allele List at MGI

All alleles(59) : Targeted(2) Gene trapped(56) Transgenic(1)

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc1	T	A	16: 14,460,978	Y1051N	probably benign	Het
Bach1	T	C	16: 87,719,545	S325P	probably benign	Het
Baz2a	T	C	10: 128,124,917	S1529P	probably damaging	Het
BC027072	A	T	17: 71,752,640	V14D	probably damaging	Het
Bicd1	T	C	6: 149,494,636	L168P	probably damaging	Het
Cat	A	G	2: 103,472,973	F153S	probably damaging	Het
Ccnt2	T	C	1: 127,802,664	M426T	probably benign	Het
Cdk7	C	T	13: 100,730,472	V38I	probably damaging	Het
Cenpj	T	C	14: 56,526,983	Y1324C	probably damaging	Het
Ddx47	C	A	6: 135,011,694	A18E	probably benign	Het
Dnah2	G	A	11: 69,437,188	Q3370*	probably null	Het
Dnah6	C	T	6: 73,159,229	V976I	probably benign	Het
Dock7	C	T	4: 98,953,868		probably benign	Het
Dpy19l3	A	T	7: 35,714,130	I362N	possibly damaging	Het
Fam118a	A	T	15: 85,058,798	T343S	probably benign	Het
Fcgbp	T	A	7: 28,093,635	D1021E	probably benign	Het
Fkbp1b	T	C	12: 4,833,746	Y83C	probably damaging	Het
Flt4	T	C	11: 49,634,754	I709T	probably damaging	Het
Gga3	G	T	11: 115,587,436	A510D	probably damaging	Het
Heatr1	T	C	13: 12,402,760	I264T	probably damaging	Het
Heatr1	T	C	13: 12,404,948	I384T	probably benign	Het
Hes2	T	C	4: 152,160,392	V106A	probably benign	Het
Igf1r	T	A	7: 68,207,821	M1083K	probably damaging	Het
Il7r	A	T	15: 9,512,924	D166E	probably benign	Het
Ipo4	G	A	14: 55,632,050		probably null	Het
Klk1b26	T	C	7: 44,012,763	I15T	probably benign	Het
Krt42	T	C	11: 100,263,295		probably benign	Het
Lag3	T	C	6: 124,908,629	T263A	probably damaging	Het
Lilra6	T	A	7: 3,914,587		probably benign	Het
Lrrc31	T	A	3: 30,691,228	H90L	probably damaging	Het
Lvrn	G	A	18: 46,873,803	D331N	probably damaging	Het
Me2	A	T	18: 73,791,116	W342R	probably damaging	Het
Mob2	A	G	7: 142,009,410	F220S	probably damaging	Het
Mroh4	A	G	15: 74,615,016	I342T	probably damaging	Het
Naa15	T	C	3: 51,441,947	Y46H	probably damaging	Het
Neb	A	G	2: 52,334,453	V10A	unknown	Het
Nlrc5	A	G	8: 94,490,416	H1011R	probably damaging	Het
Nr1i3	A	G	1: 171,214,352	T2A	possibly damaging	Het
Nrros	T	C	16: 32,144,470	N207S	probably damaging	Het
Olfr1356	C	T	10: 78,847,775	V47M	probably benign	Het
Olfr553	A	T	7: 102,614,561	S143T	probably benign	Het
Ptprz1	C	T	6: 23,000,053	T714I	possibly damaging	Het
Rp1	T	C	1: 4,346,393	T1499A	possibly damaging	Het
Rsg1	C	A	4: 141,219,992	A228D	probably damaging	Het
Rubcn	T	C	16: 32,826,711	K771E	probably damaging	Het
Sbds	T	C	5: 130,246,406	E227G	possibly damaging	Het
Setd1a	C	T	7: 127,785,629	P8S	probably damaging	Het
Sh3tc2	A	G	18: 62,011,861	I1129V	probably benign	Het
Spef1	T	A	2: 131,172,741	D87V	probably damaging	Het
Supv3l1	C	T	10: 62,429,829	R644Q	probably damaging	Het
Thoc6	A	G	17: 23,670,795	F51S	probably damaging	Het
Tm4sf19	T	C	16: 32,407,921	L176P	probably damaging	Het
Tma16	A	G	8: 66,484,124	I17T	possibly damaging	Het
Tpd52l2	G	A	2: 181,502,054		probably null	Het
Ube2j1	C	T	4: 33,045,164	P146S	probably benign	Het
Usp13	A	G	3: 32,865,838	D224G	probably damaging	Het
Uxs1	T	C	1: 43,780,080	T188A	probably damaging	Het
Vmn2r12	A	T	5: 109,086,617	Y576*	probably null	Het
Vmn2r73	T	C	7: 85,858,367	D579G	possibly damaging	Het
Xpr1	T	C	1: 155,290,235	N524D	probably benign	Het
Xrn2	A	T	2: 147,029,755	I366L	probably benign	Het
Zfp236	A	T	18: 82,658,034	V386E	possibly damaging	Het
Zfp292	A	T	4: 34,806,261	L2261Q	probably damaging	Het
Zpld1	C	G	16: 55,226,362	E415Q	probably benign	Het

Other mutations in Ubr4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00087:Ubr4	APN	4	139465322	missense	possibly damaging	0.46
IGL00336:Ubr4	APN	4	139428566	missense	probably damaging	1.00
IGL00586:Ubr4	APN	4	139455184	missense	possibly damaging	0.95
IGL00659:Ubr4	APN	4	139421245	missense	probably damaging	1.00
IGL00766:Ubr4	APN	4	139440766	missense	probably damaging	1.00
IGL00819:Ubr4	APN	4	139476282	missense	possibly damaging	0.92
IGL00833:Ubr4	APN	4	139393159	critical splice donor site	probably null
IGL01126:Ubr4	APN	4	139402555	missense	probably benign	0.04
IGL01311:Ubr4	APN	4	139479045	missense	possibly damaging	0.66
IGL01349:Ubr4	APN	4	139480728	missense	unknown
IGL01388:Ubr4	APN	4	139460243	missense	possibly damaging	0.76
IGL01417:Ubr4	APN	4	139410800	missense	probably damaging	0.99
IGL01446:Ubr4	APN	4	139438040	splice site	probably benign
IGL01449:Ubr4	APN	4	139412736	missense	probably damaging	0.98
IGL01545:Ubr4	APN	4	139442829	splice site	probably benign
IGL01568:Ubr4	APN	4	139421373	missense	probably damaging	1.00
IGL01596:Ubr4	APN	4	139462534	splice site	probably benign
IGL01621:Ubr4	APN	4	139440783	nonsense	probably null
IGL01639:Ubr4	APN	4	139417344	missense	probably damaging	0.99
IGL01655:Ubr4	APN	4	139407796	missense	probably damaging	1.00
IGL01710:Ubr4	APN	4	139418461	missense	possibly damaging	0.81
IGL01830:Ubr4	APN	4	139472500	missense	probably damaging	0.99
IGL01862:Ubr4	APN	4	139477158	missense	possibly damaging	0.66
IGL01868:Ubr4	APN	4	139412678	nonsense	probably null
IGL01874:Ubr4	APN	4	139393289	splice site	probably benign
IGL01889:Ubr4	APN	4	139462472	nonsense	probably null
IGL01891:Ubr4	APN	4	139436260	critical splice donor site	probably null
IGL01980:Ubr4	APN	4	139429602	missense	probably damaging	0.99
IGL02126:Ubr4	APN	4	139452741	critical splice donor site	probably null
IGL02153:Ubr4	APN	4	139460160	nonsense	probably null
IGL02173:Ubr4	APN	4	139437070	splice site	probably null
IGL02214:Ubr4	APN	4	139428583	missense	possibly damaging	0.95
IGL02214:Ubr4	APN	4	139461827	critical splice acceptor site	probably null
IGL02220:Ubr4	APN	4	139388435	missense	probably benign	0.01
IGL02246:Ubr4	APN	4	139459103	missense	possibly damaging	0.89
IGL02264:Ubr4	APN	4	139455628	nonsense	probably null
IGL02273:Ubr4	APN	4	139472578	missense	possibly damaging	0.94
IGL02316:Ubr4	APN	4	139473178	missense	possibly damaging	0.46
IGL02328:Ubr4	APN	4	139478922	missense	probably damaging	0.97
IGL02476:Ubr4	APN	4	139421249	nonsense	probably null
IGL02477:Ubr4	APN	4	139436205	missense	probably damaging	0.98
IGL02544:Ubr4	APN	4	139415118	missense	probably damaging	1.00
IGL02622:Ubr4	APN	4	139467250	nonsense	probably null
IGL02679:Ubr4	APN	4	139459134	missense	probably damaging	0.99
IGL02728:Ubr4	APN	4	139468811	missense	probably damaging	1.00
IGL02754:Ubr4	APN	4	139410784	missense	probably damaging	0.99
IGL02754:Ubr4	APN	4	139393159	critical splice donor site	probably null
IGL02892:Ubr4	APN	4	139417331	missense	probably damaging	0.96
IGL02897:Ubr4	APN	4	139472508	missense	probably damaging	0.97
IGL02946:Ubr4	APN	4	139425295	missense	probably damaging	1.00
IGL02964:Ubr4	APN	4	139407820	missense	possibly damaging	0.84
IGL03059:Ubr4	APN	4	139480676	missense	probably damaging	0.98
IGL03068:Ubr4	APN	4	139409730	missense	probably benign	0.02
IGL03087:Ubr4	APN	4	139450357	nonsense	probably null
IGL03116:Ubr4	APN	4	139479581	splice site	probably benign
IGL03212:Ubr4	APN	4	139409763	missense	probably benign	0.13
IGL03228:Ubr4	APN	4	139429598	missense	probably damaging	1.00
IGL03292:Ubr4	APN	4	139440435	missense	probably damaging	1.00
IGL03388:Ubr4	APN	4	139415032	missense	probably damaging	0.98
IGL03393:Ubr4	APN	4	139452678	missense	probably damaging	1.00
IGL03409:Ubr4	APN	4	139399929	nonsense	probably null
Aqua_regia	UTSW	4	139452719	nonsense	probably null
P0019:Ubr4	UTSW	4	139451781	missense	probably damaging	1.00
PIT4544001:Ubr4	UTSW	4	139402560	missense	possibly damaging	0.93
R0001:Ubr4	UTSW	4	139451788	missense	probably damaging	1.00
R0002:Ubr4	UTSW	4	139390900	missense	probably damaging	1.00
R0006:Ubr4	UTSW	4	139431649	missense	probably benign	0.03
R0006:Ubr4	UTSW	4	139431649	missense	probably benign	0.03
R0008:Ubr4	UTSW	4	139430176	missense	probably damaging	1.00
R0027:Ubr4	UTSW	4	139400393	missense	probably damaging	0.99
R0027:Ubr4	UTSW	4	139400393	missense	probably damaging	0.99
R0030:Ubr4	UTSW	4	139426793	missense	probably damaging	1.00
R0044:Ubr4	UTSW	4	139437058	splice site	probably benign
R0044:Ubr4	UTSW	4	139437058	splice site	probably benign
R0088:Ubr4	UTSW	4	139440814	missense	probably damaging	1.00
R0131:Ubr4	UTSW	4	139464051	missense	possibly damaging	0.66
R0184:Ubr4	UTSW	4	139445262	missense	probably damaging	1.00
R0219:Ubr4	UTSW	4	139430257	missense	possibly damaging	0.64
R0227:Ubr4	UTSW	4	139431649	missense	probably benign	0.03
R0270:Ubr4	UTSW	4	139479435	splice site	probably benign
R0285:Ubr4	UTSW	4	139440801	missense	probably damaging	1.00
R0322:Ubr4	UTSW	4	139422418	missense	probably damaging	1.00
R0363:Ubr4	UTSW	4	139391860	missense	probably damaging	0.98
R0393:Ubr4	UTSW	4	139410860	splice site	probably benign
R0450:Ubr4	UTSW	4	139430223	missense	probably benign	0.14
R0504:Ubr4	UTSW	4	139406578	missense	probably damaging	1.00
R0504:Ubr4	UTSW	4	139480838	critical splice donor site	probably null
R0510:Ubr4	UTSW	4	139430223	missense	probably benign	0.14
R0513:Ubr4	UTSW	4	139416875	missense	possibly damaging	0.74
R0517:Ubr4	UTSW	4	139392124	missense	probably benign	0.00
R0558:Ubr4	UTSW	4	139426902	missense	probably benign	0.09
R0617:Ubr4	UTSW	4	139479062	critical splice donor site	probably null
R0636:Ubr4	UTSW	4	139436302	intron	probably null
R0637:Ubr4	UTSW	4	139399615	missense	probably damaging	1.00
R0652:Ubr4	UTSW	4	139401326	missense	probably damaging	0.99
R0691:Ubr4	UTSW	4	139423906	missense	probably damaging	1.00
R0729:Ubr4	UTSW	4	139485320	missense	possibly damaging	0.66
R0735:Ubr4	UTSW	4	139428028	splice site	probably null
R0751:Ubr4	UTSW	4	139437198	splice site	probably benign
R0789:Ubr4	UTSW	4	139410271	critical splice donor site	probably null
R0825:Ubr4	UTSW	4	139479576	critical splice donor site	probably null
R0828:Ubr4	UTSW	4	139450553	splice site	probably benign
R1052:Ubr4	UTSW	4	139455460	missense	possibly damaging	0.83
R1184:Ubr4	UTSW	4	139437198	splice site	probably benign
R1222:Ubr4	UTSW	4	139388471	splice site	probably null
R1258:Ubr4	UTSW	4	139426914	missense	probably damaging	1.00
R1321:Ubr4	UTSW	4	139460123	missense	possibly damaging	0.46
R1385:Ubr4	UTSW	4	139402612	missense	probably benign	0.00
R1450:Ubr4	UTSW	4	139468028	missense	probably damaging	1.00
R1470:Ubr4	UTSW	4	139421226	splice site	probably null
R1470:Ubr4	UTSW	4	139421226	splice site	probably null
R1474:Ubr4	UTSW	4	139429579	missense	probably damaging	1.00
R1479:Ubr4	UTSW	4	139425840	missense	possibly damaging	0.95
R1534:Ubr4	UTSW	4	139428151	missense	possibly damaging	0.95
R1546:Ubr4	UTSW	4	139416927	nonsense	probably null
R1785:Ubr4	UTSW	4	139423945	missense	probably damaging	1.00
R1786:Ubr4	UTSW	4	139423945	missense	probably damaging	1.00
R1789:Ubr4	UTSW	4	139393053	missense	probably damaging	1.00
R1796:Ubr4	UTSW	4	139428596	missense	probably benign	0.25
R1800:Ubr4	UTSW	4	139407963	missense	probably damaging	0.99
R1801:Ubr4	UTSW	4	139452563	splice site	probably null
R1827:Ubr4	UTSW	4	139425697	critical splice acceptor site	probably null
R1887:Ubr4	UTSW	4	139455560	missense	probably damaging	1.00
R1966:Ubr4	UTSW	4	139451244	critical splice acceptor site	probably null
R2010:Ubr4	UTSW	4	139480652	missense	possibly damaging	0.92
R2049:Ubr4	UTSW	4	139477207	missense	probably damaging	0.97
R2069:Ubr4	UTSW	4	139479540	missense	possibly damaging	0.66
R2114:Ubr4	UTSW	4	139429611	nonsense	probably null
R2140:Ubr4	UTSW	4	139477207	missense	probably damaging	0.97
R2141:Ubr4	UTSW	4	139477207	missense	probably damaging	0.97
R2142:Ubr4	UTSW	4	139477207	missense	probably damaging	0.97
R2168:Ubr4	UTSW	4	139410649	missense	probably benign	0.25
R2237:Ubr4	UTSW	4	139442790	missense	probably damaging	1.00
R2249:Ubr4	UTSW	4	139448921	missense	probably damaging	1.00
R2261:Ubr4	UTSW	4	139413462	missense	probably damaging	0.99
R2264:Ubr4	UTSW	4	139420373	splice site	probably benign
R2353:Ubr4	UTSW	4	139433673	missense	possibly damaging	0.48
R2437:Ubr4	UTSW	4	139473542	missense	possibly damaging	0.90
R2496:Ubr4	UTSW	4	139473205	unclassified	probably benign
R2896:Ubr4	UTSW	4	139455644	splice site	probably null
R2922:Ubr4	UTSW	4	139479500	missense	possibly damaging	0.66
R2972:Ubr4	UTSW	4	139406536	missense	probably benign	0.22
R2973:Ubr4	UTSW	4	139406536	missense	probably benign	0.22
R2989:Ubr4	UTSW	4	139463558	missense	possibly damaging	0.89
R3176:Ubr4	UTSW	4	139421855	missense	probably benign	0.03
R3276:Ubr4	UTSW	4	139421855	missense	probably benign	0.03
R3772:Ubr4	UTSW	4	139452700	missense	possibly damaging	0.89
R3844:Ubr4	UTSW	4	139459126	missense	probably damaging	0.99
R3873:Ubr4	UTSW	4	139423990	missense	probably damaging	1.00
R3900:Ubr4	UTSW	4	139479062	critical splice donor site	probably null
R3951:Ubr4	UTSW	4	139393094	missense	probably damaging	1.00
R4020:Ubr4	UTSW	4	139451805	missense	probably damaging	0.98
R4178:Ubr4	UTSW	4	139393414	missense	probably damaging	1.00
R4308:Ubr4	UTSW	4	139472509	missense	possibly damaging	0.46
R4378:Ubr4	UTSW	4	139410440	missense	possibly damaging	0.76
R4400:Ubr4	UTSW	4	139461856	missense	possibly damaging	0.66
R4421:Ubr4	UTSW	4	139461856	missense	possibly damaging	0.66
R4462:Ubr4	UTSW	4	139418502	missense	possibly damaging	0.47
R4583:Ubr4	UTSW	4	139380853	missense	possibly damaging	0.82
R4611:Ubr4	UTSW	4	139399579	missense	possibly damaging	0.93
R4664:Ubr4	UTSW	4	139406518	missense	possibly damaging	0.56
R4671:Ubr4	UTSW	4	139436191	missense	possibly damaging	0.66
R4672:Ubr4	UTSW	4	139410716	missense	probably damaging	0.99
R4673:Ubr4	UTSW	4	139410716	missense	probably damaging	0.99
R4696:Ubr4	UTSW	4	139408672	missense	probably benign	0.09
R4701:Ubr4	UTSW	4	139471336	missense	possibly damaging	0.66
R4705:Ubr4	UTSW	4	139450529	missense	probably damaging	1.00
R4726:Ubr4	UTSW	4	139482579	missense	possibly damaging	0.46
R4728:Ubr4	UTSW	4	139423879	missense	probably damaging	1.00
R4783:Ubr4	UTSW	4	139421733	missense	possibly damaging	0.85
R4833:Ubr4	UTSW	4	139402546	missense	probably damaging	0.98
R4892:Ubr4	UTSW	4	139428517	missense	probably benign	0.14
R4936:Ubr4	UTSW	4	139396566	missense	probably damaging	0.98
R5000:Ubr4	UTSW	4	139436169	missense	probably damaging	0.98
R5114:Ubr4	UTSW	4	139410623	missense	probably damaging	0.99
R5189:Ubr4	UTSW	4	139410649	missense	probably benign	0.25
R5197:Ubr4	UTSW	4	139468097	missense	probably damaging	1.00
R5213:Ubr4	UTSW	4	139402566	nonsense	probably null
R5219:Ubr4	UTSW	4	139477232	nonsense	probably null
R5346:Ubr4	UTSW	4	139428491	missense	probably damaging	0.97
R5368:Ubr4	UTSW	4	139397528	intron	probably benign
R5442:Ubr4	UTSW	4	139407772	missense	probably damaging	1.00
R5548:Ubr4	UTSW	4	139460090	missense	probably damaging	0.97
R5568:Ubr4	UTSW	4	139392038	missense	probably damaging	0.99
R5639:Ubr4	UTSW	4	139452648	missense	possibly damaging	0.66
R5643:Ubr4	UTSW	4	139444687	missense	probably damaging	1.00
R5663:Ubr4	UTSW	4	139428583	missense	possibly damaging	0.95
R5755:Ubr4	UTSW	4	139460095	missense	possibly damaging	0.66
R5781:Ubr4	UTSW	4	139468096	missense	probably damaging	1.00
R5784:Ubr4	UTSW	4	139425218	missense	probably damaging	1.00
R5817:Ubr4	UTSW	4	139468847	missense	probably damaging	1.00
R5872:Ubr4	UTSW	4	139425330	missense	probably damaging	0.98
R5891:Ubr4	UTSW	4	139408626	nonsense	probably null
R5901:Ubr4	UTSW	4	139451254	missense	probably damaging	1.00
R5958:Ubr4	UTSW	4	139455638	missense	probably damaging	1.00
R5974:Ubr4	UTSW	4	139421078	splice site	probably null
R6065:Ubr4	UTSW	4	139421238	missense	probably damaging	1.00
R6109:Ubr4	UTSW	4	139417364	missense	probably damaging	0.99
R6207:Ubr4	UTSW	4	139421248	missense	probably damaging	1.00
R6265:Ubr4	UTSW	4	139452640	missense	possibly damaging	0.90
R6319:Ubr4	UTSW	4	139408889	missense	possibly damaging	0.84
R6342:Ubr4	UTSW	4	139429539	missense	possibly damaging	0.88
R6434:Ubr4	UTSW	4	139429638	missense	probably damaging	1.00
R6437:Ubr4	UTSW	4	139397214	critical splice donor site	probably null
R6481:Ubr4	UTSW	4	139431751	missense	probably damaging	0.97
R6502:Ubr4	UTSW	4	139444671	missense	probably damaging	1.00
R6546:Ubr4	UTSW	4	139414394	missense	probably damaging	0.99
R6603:Ubr4	UTSW	4	139455586	missense	probably benign	0.17
R6648:Ubr4	UTSW	4	139452719	nonsense	probably null
R6649:Ubr4	UTSW	4	139473624	missense	possibly damaging	0.66
R6653:Ubr4	UTSW	4	139473624	missense	possibly damaging	0.66
R6668:Ubr4	UTSW	4	139465341	missense	probably damaging	1.00
R6770:Ubr4	UTSW	4	139489182	missense	unknown
R6772:Ubr4	UTSW	4	139467230	nonsense	probably null
R6857:Ubr4	UTSW	4	139486051	missense	possibly damaging	0.90
R6869:Ubr4	UTSW	4	139467227	missense	possibly damaging	0.93
R6912:Ubr4	UTSW	4	139458234	critical splice donor site	probably null
R6943:Ubr4	UTSW	4	139437131	nonsense	probably null
R6970:Ubr4	UTSW	4	139406528	nonsense	probably null
R6976:Ubr4	UTSW	4	139393077	missense	probably damaging	0.98
R7000:Ubr4	UTSW	4	139414404	missense	probably damaging	1.00
R7017:Ubr4	UTSW	4	139393090	missense	probably damaging	0.99
R7165:Ubr4	UTSW	4	139450513	missense
R7222:Ubr4	UTSW	4	139463373	missense	unknown
R7241:Ubr4	UTSW	4	139443414	missense	probably damaging	1.00
R7343:Ubr4	UTSW	4	139413438	missense	probably benign	0.09
R7367:Ubr4	UTSW	4	139452691	missense	unknown
R7393:Ubr4	UTSW	4	139426785	missense	probably damaging	1.00
R7432:Ubr4	UTSW	4	139388382	missense	probably damaging	1.00
R7448:Ubr4	UTSW	4	139462467	missense	unknown
R7502:Ubr4	UTSW	4	139412672	missense	possibly damaging	0.72
R7514:Ubr4	UTSW	4	139452655	missense	unknown
R7526:Ubr4	UTSW	4	139422417	missense	probably benign	0.00
R7529:Ubr4	UTSW	4	139422417	missense	probably benign	0.00
R7666:Ubr4	UTSW	4	139413480	missense	possibly damaging	0.81
R7699:Ubr4	UTSW	4	139408867	nonsense	probably null
R7700:Ubr4	UTSW	4	139408867	nonsense	probably null
R7726:Ubr4	UTSW	4	139458920	missense	unknown
R7753:Ubr4	UTSW	4	139470292	missense	unknown
R7810:Ubr4	UTSW	4	139415083	missense
T0975:Ubr4	UTSW	4	139451781	missense	probably damaging	1.00
X0028:Ubr4	UTSW	4	139410271	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- AGAAAGAGCTCTGCACTCTAGC -3'
(R):5'- GGGAAGGAAGCTACCATCACTG -3'

Sequencing Primer
(F):5'- AAGCTTTGGCCAGGAGTC -3'
(R):5'- GGAAGCTACCATCACTGTTATATTC -3'

Posted On

2016-10-05