Incidental Mutation 'R5527:Bicd1'
ID431922
Institutional Source Beutler Lab
Gene Symbol Bicd1
Ensembl Gene ENSMUSG00000003452
Gene NameBICD cargo adaptor 1
SynonymsB830009D06Rik
MMRRC Submission 043085-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5527 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location149408886-149563329 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 149494636 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 168 (L168P)
Ref Sequence ENSEMBL: ENSMUSP00000133727 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003544] [ENSMUST00000086829] [ENSMUST00000111513] [ENSMUST00000173408]
Predicted Effect probably damaging
Transcript: ENSMUST00000003544
AA Change: L168P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000003544
Gene: ENSMUSG00000003452
AA Change: L168P

DomainStartEndE-ValueType
low complexity region 14 32 N/A INTRINSIC
Pfam:BicD 74 799 N/A PFAM
low complexity region 807 820 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000086829
AA Change: L168P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000084039
Gene: ENSMUSG00000003452
AA Change: L168P

DomainStartEndE-ValueType
low complexity region 14 32 N/A INTRINSIC
Pfam:BicD 74 799 N/A PFAM
low complexity region 807 820 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000111513
AA Change: L168P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107138
Gene: ENSMUSG00000003452
AA Change: L168P

DomainStartEndE-ValueType
low complexity region 14 32 N/A INTRINSIC
Pfam:BicD 74 799 N/A PFAM
low complexity region 807 822 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130270
Predicted Effect probably damaging
Transcript: ENSMUST00000173408
AA Change: L168P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000133727
Gene: ENSMUSG00000003452
AA Change: L168P

DomainStartEndE-ValueType
low complexity region 14 32 N/A INTRINSIC
Pfam:BicD 74 799 N/A PFAM
low complexity region 807 820 N/A INTRINSIC
Coding Region Coverage
  • 1x: 98.2%
  • 3x: 97.2%
  • 10x: 94.9%
  • 20x: 89.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is one of two human homologs of Drosophila bicaudal-D. It has been implicated in COPI-independent membrane transport from the Golgi apparatus to the endoplasmic reticulum. Two alternative splice variants have been described. Other alternative splice variants that encode different protein isoforms have been described but their full-length nature has not been determined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc1 T A 16: 14,460,978 Y1051N probably benign Het
Bach1 T C 16: 87,719,545 S325P probably benign Het
Baz2a T C 10: 128,124,917 S1529P probably damaging Het
BC027072 A T 17: 71,752,640 V14D probably damaging Het
Cat A G 2: 103,472,973 F153S probably damaging Het
Ccnt2 T C 1: 127,802,664 M426T probably benign Het
Cdk7 C T 13: 100,730,472 V38I probably damaging Het
Cenpj T C 14: 56,526,983 Y1324C probably damaging Het
Ddx47 C A 6: 135,011,694 A18E probably benign Het
Dnah2 G A 11: 69,437,188 Q3370* probably null Het
Dnah6 C T 6: 73,159,229 V976I probably benign Het
Dock7 C T 4: 98,953,868 probably benign Het
Dpy19l3 A T 7: 35,714,130 I362N possibly damaging Het
Fam118a A T 15: 85,058,798 T343S probably benign Het
Fcgbp T A 7: 28,093,635 D1021E probably benign Het
Fkbp1b T C 12: 4,833,746 Y83C probably damaging Het
Flt4 T C 11: 49,634,754 I709T probably damaging Het
Gga3 G T 11: 115,587,436 A510D probably damaging Het
Heatr1 T C 13: 12,402,760 I264T probably damaging Het
Heatr1 T C 13: 12,404,948 I384T probably benign Het
Hes2 T C 4: 152,160,392 V106A probably benign Het
Igf1r T A 7: 68,207,821 M1083K probably damaging Het
Il7r A T 15: 9,512,924 D166E probably benign Het
Ipo4 G A 14: 55,632,050 probably null Het
Klk1b26 T C 7: 44,012,763 I15T probably benign Het
Krt42 T C 11: 100,263,295 probably benign Het
Lag3 T C 6: 124,908,629 T263A probably damaging Het
Lilra6 T A 7: 3,914,587 probably benign Het
Lrrc31 T A 3: 30,691,228 H90L probably damaging Het
Lvrn G A 18: 46,873,803 D331N probably damaging Het
Me2 A T 18: 73,791,116 W342R probably damaging Het
Mob2 A G 7: 142,009,410 F220S probably damaging Het
Mroh4 A G 15: 74,615,016 I342T probably damaging Het
Naa15 T C 3: 51,441,947 Y46H probably damaging Het
Neb A G 2: 52,334,453 V10A unknown Het
Nlrc5 A G 8: 94,490,416 H1011R probably damaging Het
Nr1i3 A G 1: 171,214,352 T2A possibly damaging Het
Nrros T C 16: 32,144,470 N207S probably damaging Het
Olfr1356 C T 10: 78,847,775 V47M probably benign Het
Olfr553 A T 7: 102,614,561 S143T probably benign Het
Ptprz1 C T 6: 23,000,053 T714I possibly damaging Het
Rp1 T C 1: 4,346,393 T1499A possibly damaging Het
Rsg1 C A 4: 141,219,992 A228D probably damaging Het
Rubcn T C 16: 32,826,711 K771E probably damaging Het
Sbds T C 5: 130,246,406 E227G possibly damaging Het
Setd1a C T 7: 127,785,629 P8S probably damaging Het
Sh3tc2 A G 18: 62,011,861 I1129V probably benign Het
Spef1 T A 2: 131,172,741 D87V probably damaging Het
Supv3l1 C T 10: 62,429,829 R644Q probably damaging Het
Thoc6 A G 17: 23,670,795 F51S probably damaging Het
Tm4sf19 T C 16: 32,407,921 L176P probably damaging Het
Tma16 A G 8: 66,484,124 I17T possibly damaging Het
Tpd52l2 G A 2: 181,502,054 probably null Het
Ube2j1 C T 4: 33,045,164 P146S probably benign Het
Ubr4 T A 4: 139,480,788 I4960N possibly damaging Het
Usp13 A G 3: 32,865,838 D224G probably damaging Het
Uxs1 T C 1: 43,780,080 T188A probably damaging Het
Vmn2r12 A T 5: 109,086,617 Y576* probably null Het
Vmn2r73 T C 7: 85,858,367 D579G possibly damaging Het
Xpr1 T C 1: 155,290,235 N524D probably benign Het
Xrn2 A T 2: 147,029,755 I366L probably benign Het
Zfp236 A T 18: 82,658,034 V386E possibly damaging Het
Zfp292 A T 4: 34,806,261 L2261Q probably damaging Het
Zpld1 C G 16: 55,226,362 E415Q probably benign Het
Other mutations in Bicd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Bicd1 APN 6 149550390 missense possibly damaging 0.72
IGL02489:Bicd1 APN 6 149513037 missense probably damaging 1.00
IGL02626:Bicd1 APN 6 149409556 missense probably damaging 1.00
IGL02966:Bicd1 APN 6 149483996 missense probably damaging 0.99
IGL03256:Bicd1 APN 6 149513585 missense probably benign
R0123:Bicd1 UTSW 6 149512950 missense probably benign 0.00
R0131:Bicd1 UTSW 6 149512947 missense probably damaging 0.99
R0134:Bicd1 UTSW 6 149512950 missense probably benign 0.00
R0225:Bicd1 UTSW 6 149512950 missense probably benign 0.00
R0267:Bicd1 UTSW 6 149517042 missense probably damaging 1.00
R0481:Bicd1 UTSW 6 149511891 missense possibly damaging 0.90
R0560:Bicd1 UTSW 6 149511962 missense probably benign 0.34
R0729:Bicd1 UTSW 6 149512914 missense probably damaging 0.97
R0784:Bicd1 UTSW 6 149513363 missense probably damaging 0.98
R1994:Bicd1 UTSW 6 149513552 missense probably benign 0.00
R2221:Bicd1 UTSW 6 149517005 missense probably damaging 0.98
R2762:Bicd1 UTSW 6 149520403 missense probably damaging 0.99
R3428:Bicd1 UTSW 6 149512902 missense probably damaging 1.00
R3805:Bicd1 UTSW 6 149518991 missense probably damaging 1.00
R3806:Bicd1 UTSW 6 149518991 missense probably damaging 1.00
R3807:Bicd1 UTSW 6 149518991 missense probably damaging 1.00
R4694:Bicd1 UTSW 6 149409553 missense probably damaging 1.00
R4822:Bicd1 UTSW 6 149519254 intron probably benign
R4835:Bicd1 UTSW 6 149484090 missense probably benign 0.00
R5157:Bicd1 UTSW 6 149520414 missense probably benign 0.09
R5611:Bicd1 UTSW 6 149513456 nonsense probably null
R5643:Bicd1 UTSW 6 149520403 missense probably damaging 0.99
R5644:Bicd1 UTSW 6 149520403 missense probably damaging 0.99
R5788:Bicd1 UTSW 6 149484000 missense probably benign 0.39
R5898:Bicd1 UTSW 6 149513703 missense probably damaging 0.99
R6222:Bicd1 UTSW 6 149512965 missense probably damaging 1.00
R6227:Bicd1 UTSW 6 149513176 nonsense probably null
R6522:Bicd1 UTSW 6 149484005 missense probably benign
R6781:Bicd1 UTSW 6 149513166 missense possibly damaging 0.86
R6812:Bicd1 UTSW 6 149409537 missense probably damaging 1.00
R7010:Bicd1 UTSW 6 149494615 missense probably damaging 1.00
R7203:Bicd1 UTSW 6 149512905 missense possibly damaging 0.91
R7265:Bicd1 UTSW 6 149513876 missense probably damaging 1.00
R7362:Bicd1 UTSW 6 149484093 missense probably benign 0.13
R7526:Bicd1 UTSW 6 149513726 missense possibly damaging 0.46
R7545:Bicd1 UTSW 6 149513492 missense probably benign
R7581:Bicd1 UTSW 6 149519004 missense probably damaging 1.00
R7589:Bicd1 UTSW 6 149513667 missense possibly damaging 0.61
R7639:Bicd1 UTSW 6 149513004 missense possibly damaging 0.92
R7715:Bicd1 UTSW 6 149512973 missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- CCCATTCTTTGTGTGAATAAACATG -3'
(R):5'- AGCAGTTAAGAGGACTTCTGTG -3'

Sequencing Primer
(F):5'- TCATCTTAAAAGGCAGTACCAGGCTG -3'
(R):5'- AAGAGGACTTCTGTGTGTGCTCATAC -3'
Posted On2016-10-05