Incidental Mutation 'R5527:Setd1a'
ID 431929
Institutional Source Beutler Lab
Gene Symbol Setd1a
Ensembl Gene ENSMUSG00000042308
Gene Name SET domain containing 1A
Synonyms KMT2F
MMRRC Submission 043085-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R5527 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 127376561-127399294 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 127384801 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Proline to Serine at position 8 (P8S)
Ref Sequence ENSEMBL: ENSMUSP00000145647 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047075] [ENSMUST00000047157] [ENSMUST00000126761] [ENSMUST00000144406] [ENSMUST00000154987]
AlphaFold E9PYH6
Predicted Effect possibly damaging
Transcript: ENSMUST00000047075
AA Change: P551S

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000047672
Gene: ENSMUSG00000042308
AA Change: P551S

DomainStartEndE-ValueType
RRM 95 168 7.6e-6 SMART
low complexity region 209 242 N/A INTRINSIC
low complexity region 278 295 N/A INTRINSIC
low complexity region 315 357 N/A INTRINSIC
low complexity region 427 487 N/A INTRINSIC
Blast:SET 488 976 N/A BLAST
low complexity region 977 1007 N/A INTRINSIC
low complexity region 1015 1079 N/A INTRINSIC
low complexity region 1087 1098 N/A INTRINSIC
low complexity region 1122 1152 N/A INTRINSIC
low complexity region 1157 1173 N/A INTRINSIC
Blast:SET 1193 1310 2e-24 BLAST
low complexity region 1311 1368 N/A INTRINSIC
low complexity region 1369 1396 N/A INTRINSIC
N-SET 1428 1567 6.75e-64 SMART
SET 1577 1700 3.22e-35 SMART
PostSET 1700 1716 1.16e-4 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000047157
AA Change: P551S

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000037600
Gene: ENSMUSG00000042308
AA Change: P551S

DomainStartEndE-ValueType
RRM 95 168 7.6e-6 SMART
low complexity region 209 242 N/A INTRINSIC
low complexity region 278 295 N/A INTRINSIC
low complexity region 315 357 N/A INTRINSIC
low complexity region 427 487 N/A INTRINSIC
Blast:SET 488 976 N/A BLAST
low complexity region 977 1007 N/A INTRINSIC
low complexity region 1015 1079 N/A INTRINSIC
low complexity region 1087 1098 N/A INTRINSIC
low complexity region 1122 1152 N/A INTRINSIC
low complexity region 1157 1173 N/A INTRINSIC
Blast:SET 1193 1310 2e-24 BLAST
low complexity region 1311 1368 N/A INTRINSIC
low complexity region 1369 1396 N/A INTRINSIC
N-SET 1428 1567 6.75e-64 SMART
SET 1577 1700 3.22e-35 SMART
PostSET 1700 1716 1.16e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000126761
SMART Domains Protein: ENSMUSP00000120666
Gene: ENSMUSG00000042308

DomainStartEndE-ValueType
RRM 95 168 7.6e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141439
Predicted Effect probably benign
Transcript: ENSMUST00000144406
SMART Domains Protein: ENSMUSP00000115248
Gene: ENSMUSG00000042308

DomainStartEndE-ValueType
RRM 95 168 7.6e-6 SMART
low complexity region 209 242 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000154987
AA Change: P8S

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
Coding Region Coverage
  • 1x: 98.2%
  • 3x: 97.2%
  • 10x: 94.9%
  • 20x: 89.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of a histone methyltransferase (HMT) complex that produces mono-, di-, and trimethylated histone H3 at Lys4. Trimethylation of histone H3 at lysine 4 (H3K4me3) is a chromatin modification known to generally mark the transcription start sites of active genes. The protein contains SET domains, a RNA recognition motif domain and is a member of the class V-like SAM-binding methyltransferase superfamily. [provided by RefSeq, Dec 2016]
PHENOTYPE: Animals homozygous for this allele were dead by E7.5 [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc1 T A 16: 14,278,842 (GRCm39) Y1051N probably benign Het
Bach1 T C 16: 87,516,433 (GRCm39) S325P probably benign Het
Baz2a T C 10: 127,960,786 (GRCm39) S1529P probably damaging Het
Bicd1 T C 6: 149,396,134 (GRCm39) L168P probably damaging Het
Cat A G 2: 103,303,318 (GRCm39) F153S probably damaging Het
Ccnt2 T C 1: 127,730,401 (GRCm39) M426T probably benign Het
Cdk7 C T 13: 100,866,980 (GRCm39) V38I probably damaging Het
Cenpj T C 14: 56,764,440 (GRCm39) Y1324C probably damaging Het
Cplane2 C A 4: 140,947,303 (GRCm39) A228D probably damaging Het
Ddx47 C A 6: 134,988,657 (GRCm39) A18E probably benign Het
Dnah2 G A 11: 69,328,014 (GRCm39) Q3370* probably null Het
Dnah6 C T 6: 73,136,212 (GRCm39) V976I probably benign Het
Dock7 C T 4: 98,842,105 (GRCm39) probably benign Het
Dpy19l3 A T 7: 35,413,555 (GRCm39) I362N possibly damaging Het
Fam118a A T 15: 84,942,999 (GRCm39) T343S probably benign Het
Fcgbp T A 7: 27,793,060 (GRCm39) D1021E probably benign Het
Fkbp1b T C 12: 4,883,746 (GRCm39) Y83C probably damaging Het
Flt4 T C 11: 49,525,581 (GRCm39) I709T probably damaging Het
Gga3 G T 11: 115,478,262 (GRCm39) A510D probably damaging Het
Heatr1 T C 13: 12,417,641 (GRCm39) I264T probably damaging Het
Heatr1 T C 13: 12,419,829 (GRCm39) I384T probably benign Het
Hes2 T C 4: 152,244,849 (GRCm39) V106A probably benign Het
Igf1r T A 7: 67,857,569 (GRCm39) M1083K probably damaging Het
Il7r A T 15: 9,513,010 (GRCm39) D166E probably benign Het
Ipo4 G A 14: 55,869,507 (GRCm39) probably null Het
Klk1b26 T C 7: 43,662,187 (GRCm39) I15T probably benign Het
Krt42 T C 11: 100,154,121 (GRCm39) probably benign Het
Lag3 T C 6: 124,885,592 (GRCm39) T263A probably damaging Het
Lilra6 T A 7: 3,917,586 (GRCm39) probably benign Het
Lrrc31 T A 3: 30,745,377 (GRCm39) H90L probably damaging Het
Lvrn G A 18: 47,006,870 (GRCm39) D331N probably damaging Het
Me2 A T 18: 73,924,187 (GRCm39) W342R probably damaging Het
Mob2 A G 7: 141,563,147 (GRCm39) F220S probably damaging Het
Mroh4 A G 15: 74,486,865 (GRCm39) I342T probably damaging Het
Naa15 T C 3: 51,349,368 (GRCm39) Y46H probably damaging Het
Neb A G 2: 52,224,465 (GRCm39) V10A unknown Het
Nlrc5 A G 8: 95,217,044 (GRCm39) H1011R probably damaging Het
Nr1i3 A G 1: 171,041,921 (GRCm39) T2A possibly damaging Het
Nrros T C 16: 31,963,288 (GRCm39) N207S probably damaging Het
Or52m2 A T 7: 102,263,768 (GRCm39) S143T probably benign Het
Or7c70 C T 10: 78,683,609 (GRCm39) V47M probably benign Het
Pcare A T 17: 72,059,635 (GRCm39) V14D probably damaging Het
Ptprz1 C T 6: 23,000,052 (GRCm39) T714I possibly damaging Het
Rp1 T C 1: 4,416,616 (GRCm39) T1499A possibly damaging Het
Rubcn T C 16: 32,647,081 (GRCm39) K771E probably damaging Het
Sbds T C 5: 130,275,247 (GRCm39) E227G possibly damaging Het
Sh3tc2 A G 18: 62,144,932 (GRCm39) I1129V probably benign Het
Spef1 T A 2: 131,014,661 (GRCm39) D87V probably damaging Het
Supv3l1 C T 10: 62,265,608 (GRCm39) R644Q probably damaging Het
Thoc6 A G 17: 23,889,769 (GRCm39) F51S probably damaging Het
Tm4sf19 T C 16: 32,226,739 (GRCm39) L176P probably damaging Het
Tma16 A G 8: 66,936,776 (GRCm39) I17T possibly damaging Het
Tpd52l2 G A 2: 181,143,847 (GRCm39) probably null Het
Ube2j1 C T 4: 33,045,164 (GRCm39) P146S probably benign Het
Ubr4 T A 4: 139,208,099 (GRCm39) I4960N possibly damaging Het
Usp13 A G 3: 32,919,987 (GRCm39) D224G probably damaging Het
Uxs1 T C 1: 43,819,240 (GRCm39) T188A probably damaging Het
Vmn2r12 A T 5: 109,234,483 (GRCm39) Y576* probably null Het
Vmn2r73 T C 7: 85,507,575 (GRCm39) D579G possibly damaging Het
Xpr1 T C 1: 155,165,981 (GRCm39) N524D probably benign Het
Xrn2 A T 2: 146,871,675 (GRCm39) I366L probably benign Het
Zfp236 A T 18: 82,676,159 (GRCm39) V386E possibly damaging Het
Zfp292 A T 4: 34,806,261 (GRCm39) L2261Q probably damaging Het
Zpld1 C G 16: 55,046,725 (GRCm39) E415Q probably benign Het
Other mutations in Setd1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02508:Setd1a APN 7 127,396,870 (GRCm39) unclassified probably benign
IGL02657:Setd1a APN 7 127,394,997 (GRCm39) unclassified probably benign
IGL02792:Setd1a APN 7 127,390,522 (GRCm39) missense unknown
IGL02876:Setd1a APN 7 127,377,673 (GRCm39) splice site probably benign
IGL02967:Setd1a APN 7 127,384,349 (GRCm39) unclassified probably benign
IGL03090:Setd1a APN 7 127,385,672 (GRCm39) missense possibly damaging 0.83
IGL03238:Setd1a APN 7 127,384,718 (GRCm39) missense possibly damaging 0.86
FR4449:Setd1a UTSW 7 127,384,498 (GRCm39) unclassified probably benign
FR4548:Setd1a UTSW 7 127,384,485 (GRCm39) unclassified probably benign
FR4548:Setd1a UTSW 7 127,384,479 (GRCm39) unclassified probably benign
FR4589:Setd1a UTSW 7 127,384,469 (GRCm39) unclassified probably benign
FR4737:Setd1a UTSW 7 127,384,484 (GRCm39) unclassified probably benign
FR4976:Setd1a UTSW 7 127,384,488 (GRCm39) unclassified probably benign
FR4976:Setd1a UTSW 7 127,384,479 (GRCm39) unclassified probably benign
R0367:Setd1a UTSW 7 127,387,358 (GRCm39) splice site probably benign
R0411:Setd1a UTSW 7 127,395,223 (GRCm39) unclassified probably benign
R0416:Setd1a UTSW 7 127,384,469 (GRCm39) unclassified probably benign
R0470:Setd1a UTSW 7 127,384,229 (GRCm39) unclassified probably benign
R0645:Setd1a UTSW 7 127,386,382 (GRCm39) missense probably damaging 0.96
R0667:Setd1a UTSW 7 127,385,765 (GRCm39) missense probably damaging 0.99
R1251:Setd1a UTSW 7 127,396,596 (GRCm39) unclassified probably benign
R1465:Setd1a UTSW 7 127,387,512 (GRCm39) unclassified probably benign
R1465:Setd1a UTSW 7 127,387,512 (GRCm39) unclassified probably benign
R1660:Setd1a UTSW 7 127,395,841 (GRCm39) unclassified probably benign
R1730:Setd1a UTSW 7 127,384,296 (GRCm39) nonsense probably null
R1760:Setd1a UTSW 7 127,385,062 (GRCm39) missense possibly damaging 0.68
R1783:Setd1a UTSW 7 127,384,296 (GRCm39) nonsense probably null
R2149:Setd1a UTSW 7 127,385,690 (GRCm39) missense possibly damaging 0.75
R2159:Setd1a UTSW 7 127,384,661 (GRCm39) missense possibly damaging 0.91
R2303:Setd1a UTSW 7 127,398,327 (GRCm39) unclassified probably benign
R2679:Setd1a UTSW 7 127,394,896 (GRCm39) unclassified probably benign
R3428:Setd1a UTSW 7 127,384,493 (GRCm39) unclassified probably benign
R4108:Setd1a UTSW 7 127,398,374 (GRCm39) unclassified probably benign
R4227:Setd1a UTSW 7 127,395,819 (GRCm39) unclassified probably benign
R4438:Setd1a UTSW 7 127,384,903 (GRCm39) missense possibly damaging 0.83
R4730:Setd1a UTSW 7 127,396,502 (GRCm39) unclassified probably benign
R4869:Setd1a UTSW 7 127,396,776 (GRCm39) unclassified probably benign
R4892:Setd1a UTSW 7 127,377,696 (GRCm39) missense probably damaging 0.99
R5152:Setd1a UTSW 7 127,383,197 (GRCm39) missense probably benign
R5502:Setd1a UTSW 7 127,396,420 (GRCm39) critical splice donor site probably null
R6189:Setd1a UTSW 7 127,377,455 (GRCm39) splice site probably null
R6250:Setd1a UTSW 7 127,390,471 (GRCm39) missense unknown
R7131:Setd1a UTSW 7 127,395,590 (GRCm39) small deletion probably benign
R7988:Setd1a UTSW 7 127,385,366 (GRCm39) missense probably benign 0.02
R8029:Setd1a UTSW 7 127,385,386 (GRCm39) missense probably benign 0.08
R8079:Setd1a UTSW 7 127,384,225 (GRCm39) missense unknown
R8171:Setd1a UTSW 7 127,390,399 (GRCm39) missense unknown
R8175:Setd1a UTSW 7 127,395,415 (GRCm39) missense unknown
R8286:Setd1a UTSW 7 127,385,356 (GRCm39) missense possibly damaging 0.96
R8327:Setd1a UTSW 7 127,390,669 (GRCm39) missense unknown
R8460:Setd1a UTSW 7 127,383,292 (GRCm39) missense unknown
R8547:Setd1a UTSW 7 127,395,676 (GRCm39) unclassified probably benign
R8699:Setd1a UTSW 7 127,385,774 (GRCm39) missense possibly damaging 0.53
R8822:Setd1a UTSW 7 127,385,332 (GRCm39) missense possibly damaging 0.86
R8968:Setd1a UTSW 7 127,385,279 (GRCm39) missense possibly damaging 0.93
R9063:Setd1a UTSW 7 127,385,558 (GRCm39) missense possibly damaging 0.91
R9178:Setd1a UTSW 7 127,385,590 (GRCm39) missense possibly damaging 0.93
R9672:Setd1a UTSW 7 127,385,237 (GRCm39) missense possibly damaging 0.96
R9700:Setd1a UTSW 7 127,385,752 (GRCm39) missense possibly damaging 0.53
RF001:Setd1a UTSW 7 127,384,486 (GRCm39) unclassified probably benign
RF008:Setd1a UTSW 7 127,384,486 (GRCm39) unclassified probably benign
RF011:Setd1a UTSW 7 127,384,515 (GRCm39) unclassified probably benign
RF014:Setd1a UTSW 7 127,384,518 (GRCm39) unclassified probably benign
RF030:Setd1a UTSW 7 127,384,483 (GRCm39) unclassified probably benign
RF030:Setd1a UTSW 7 127,384,473 (GRCm39) unclassified probably benign
RF031:Setd1a UTSW 7 127,384,483 (GRCm39) unclassified probably benign
RF036:Setd1a UTSW 7 127,384,472 (GRCm39) unclassified probably benign
RF041:Setd1a UTSW 7 127,384,504 (GRCm39) unclassified probably benign
RF052:Setd1a UTSW 7 127,384,529 (GRCm39) unclassified probably benign
RF055:Setd1a UTSW 7 127,384,471 (GRCm39) unclassified probably benign
RF056:Setd1a UTSW 7 127,384,500 (GRCm39) unclassified probably benign
RF056:Setd1a UTSW 7 127,384,475 (GRCm39) unclassified probably benign
RF058:Setd1a UTSW 7 127,384,490 (GRCm39) unclassified probably benign
Z1176:Setd1a UTSW 7 127,398,266 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- TGCTCAGCACAGCAGTTTG -3'
(R):5'- AGGAGAGTCACAGACAGCTC -3'

Sequencing Primer
(F):5'- AGCACAGCAGTTTGGATTCC -3'
(R):5'- GCTAGAGCTCCCTGAGTTTGC -3'
Posted On 2016-10-05