Incidental Mutation 'R5527:Flt4'
ID431936
Institutional Source Beutler Lab
Gene Symbol Flt4
Ensembl Gene ENSMUSG00000020357
Gene NameFMS-like tyrosine kinase 4
SynonymsVEGFR-3, Flt-4, VEGFR3
MMRRC Submission 043085-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5527 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location49609263-49652739 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 49634754 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 709 (I709T)
Ref Sequence ENSEMBL: ENSMUSP00000020617 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020617]
Predicted Effect probably damaging
Transcript: ENSMUST00000020617
AA Change: I709T

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000020617
Gene: ENSMUSG00000020357
AA Change: I709T

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IG 36 133 3.73e0 SMART
IG 237 328 3.15e-10 SMART
IG 341 419 4.5e0 SMART
IG 430 552 8.46e-2 SMART
IGc2 569 660 1.29e-6 SMART
IGc2 690 755 2.48e-17 SMART
transmembrane domain 776 798 N/A INTRINSIC
TyrKc 845 1169 2.2e-134 SMART
Coding Region Coverage
  • 1x: 98.2%
  • 3x: 97.2%
  • 10x: 94.9%
  • 20x: 89.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a tyrosine kinase receptor for vascular endothelial growth factors C and D. The protein is thought to be involved in lymphangiogenesis and maintenance of the lymphatic endothelium. Mutations in this gene cause hereditary lymphedema type IA. [provided by RefSeq, Jul 2008]
PHENOTYPE: Embryos homozygous for a targeted null mutation show growth retardation, vascular abnormalities, severe anemia and die from cardiovascular failure at embryonic day 9.5. Heterozygotes for another mutation show abdominal chylous ascites, abnormal lymphaticvessels, and lymphedema. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc1 T A 16: 14,460,978 Y1051N probably benign Het
Bach1 T C 16: 87,719,545 S325P probably benign Het
Baz2a T C 10: 128,124,917 S1529P probably damaging Het
BC027072 A T 17: 71,752,640 V14D probably damaging Het
Bicd1 T C 6: 149,494,636 L168P probably damaging Het
Cat A G 2: 103,472,973 F153S probably damaging Het
Ccnt2 T C 1: 127,802,664 M426T probably benign Het
Cdk7 C T 13: 100,730,472 V38I probably damaging Het
Cenpj T C 14: 56,526,983 Y1324C probably damaging Het
Ddx47 C A 6: 135,011,694 A18E probably benign Het
Dnah2 G A 11: 69,437,188 Q3370* probably null Het
Dnah6 C T 6: 73,159,229 V976I probably benign Het
Dock7 C T 4: 98,953,868 probably benign Het
Dpy19l3 A T 7: 35,714,130 I362N possibly damaging Het
Fam118a A T 15: 85,058,798 T343S probably benign Het
Fcgbp T A 7: 28,093,635 D1021E probably benign Het
Fkbp1b T C 12: 4,833,746 Y83C probably damaging Het
Gga3 G T 11: 115,587,436 A510D probably damaging Het
Heatr1 T C 13: 12,402,760 I264T probably damaging Het
Heatr1 T C 13: 12,404,948 I384T probably benign Het
Hes2 T C 4: 152,160,392 V106A probably benign Het
Igf1r T A 7: 68,207,821 M1083K probably damaging Het
Il7r A T 15: 9,512,924 D166E probably benign Het
Ipo4 G A 14: 55,632,050 probably null Het
Klk1b26 T C 7: 44,012,763 I15T probably benign Het
Krt42 T C 11: 100,263,295 probably benign Het
Lag3 T C 6: 124,908,629 T263A probably damaging Het
Lilra6 T A 7: 3,914,587 probably benign Het
Lrrc31 T A 3: 30,691,228 H90L probably damaging Het
Lvrn G A 18: 46,873,803 D331N probably damaging Het
Me2 A T 18: 73,791,116 W342R probably damaging Het
Mob2 A G 7: 142,009,410 F220S probably damaging Het
Mroh4 A G 15: 74,615,016 I342T probably damaging Het
Naa15 T C 3: 51,441,947 Y46H probably damaging Het
Neb A G 2: 52,334,453 V10A unknown Het
Nlrc5 A G 8: 94,490,416 H1011R probably damaging Het
Nr1i3 A G 1: 171,214,352 T2A possibly damaging Het
Nrros T C 16: 32,144,470 N207S probably damaging Het
Olfr1356 C T 10: 78,847,775 V47M probably benign Het
Olfr553 A T 7: 102,614,561 S143T probably benign Het
Ptprz1 C T 6: 23,000,053 T714I possibly damaging Het
Rp1 T C 1: 4,346,393 T1499A possibly damaging Het
Rsg1 C A 4: 141,219,992 A228D probably damaging Het
Rubcn T C 16: 32,826,711 K771E probably damaging Het
Sbds T C 5: 130,246,406 E227G possibly damaging Het
Setd1a C T 7: 127,785,629 P8S probably damaging Het
Sh3tc2 A G 18: 62,011,861 I1129V probably benign Het
Spef1 T A 2: 131,172,741 D87V probably damaging Het
Supv3l1 C T 10: 62,429,829 R644Q probably damaging Het
Thoc6 A G 17: 23,670,795 F51S probably damaging Het
Tm4sf19 T C 16: 32,407,921 L176P probably damaging Het
Tma16 A G 8: 66,484,124 I17T possibly damaging Het
Tpd52l2 G A 2: 181,502,054 probably null Het
Ube2j1 C T 4: 33,045,164 P146S probably benign Het
Ubr4 T A 4: 139,480,788 I4960N possibly damaging Het
Usp13 A G 3: 32,865,838 D224G probably damaging Het
Uxs1 T C 1: 43,780,080 T188A probably damaging Het
Vmn2r12 A T 5: 109,086,617 Y576* probably null Het
Vmn2r73 T C 7: 85,858,367 D579G possibly damaging Het
Xpr1 T C 1: 155,290,235 N524D probably benign Het
Xrn2 A T 2: 147,029,755 I366L probably benign Het
Zfp236 A T 18: 82,658,034 V386E possibly damaging Het
Zfp292 A T 4: 34,806,261 L2261Q probably damaging Het
Zpld1 C G 16: 55,226,362 E415Q probably benign Het
Other mutations in Flt4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00499:Flt4 APN 11 49635261 missense probably damaging 1.00
IGL01140:Flt4 APN 11 49634943 nonsense probably null
IGL01360:Flt4 APN 11 49643506 missense probably benign 0.04
IGL01386:Flt4 APN 11 49637335 missense probably benign 0.00
IGL01769:Flt4 APN 11 49635171 splice site probably benign
IGL02189:Flt4 APN 11 49626003 missense probably damaging 1.00
IGL02206:Flt4 APN 11 49630390 missense probably damaging 0.98
IGL02324:Flt4 APN 11 49645995 missense probably benign 0.13
IGL02433:Flt4 APN 11 49630573 missense probably benign 0.01
IGL03009:Flt4 APN 11 49627124 missense probably benign 0.02
IGL03035:Flt4 APN 11 49645897 nonsense probably null
IGL03059:Flt4 APN 11 49642307 missense probably damaging 0.97
IGL03350:Flt4 APN 11 49634793 nonsense probably null
PIT4802001:Flt4 UTSW 11 49633169 missense probably benign
R0360:Flt4 UTSW 11 49636991 missense probably benign 0.02
R0364:Flt4 UTSW 11 49636991 missense probably benign 0.02
R0386:Flt4 UTSW 11 49644386 missense probably benign 0.00
R0395:Flt4 UTSW 11 49630343 missense probably benign 0.00
R0600:Flt4 UTSW 11 49636339 splice site probably benign
R0666:Flt4 UTSW 11 49625447 missense possibly damaging 0.53
R0720:Flt4 UTSW 11 49636339 splice site probably benign
R0734:Flt4 UTSW 11 49626717 missense possibly damaging 0.67
R0973:Flt4 UTSW 11 49636339 splice site probably benign
R1013:Flt4 UTSW 11 49636339 splice site probably benign
R1103:Flt4 UTSW 11 49636339 splice site probably benign
R1104:Flt4 UTSW 11 49636339 splice site probably benign
R1162:Flt4 UTSW 11 49636339 splice site probably benign
R1241:Flt4 UTSW 11 49636339 splice site probably benign
R1401:Flt4 UTSW 11 49636339 splice site probably benign
R1487:Flt4 UTSW 11 49633144 missense possibly damaging 0.86
R1546:Flt4 UTSW 11 49631981 missense probably benign 0.03
R1999:Flt4 UTSW 11 49645997 missense probably benign 0.00
R2110:Flt4 UTSW 11 49625304 missense probably benign 0.03
R2150:Flt4 UTSW 11 49645997 missense probably benign 0.00
R2189:Flt4 UTSW 11 49635698 missense probably benign 0.24
R2217:Flt4 UTSW 11 49624728 missense probably benign 0.00
R2218:Flt4 UTSW 11 49624728 missense probably benign 0.00
R2249:Flt4 UTSW 11 49645959 missense possibly damaging 0.66
R2402:Flt4 UTSW 11 49637819 missense possibly damaging 0.82
R3508:Flt4 UTSW 11 49634114 missense probably damaging 0.99
R3974:Flt4 UTSW 11 49636740 missense probably damaging 0.99
R4168:Flt4 UTSW 11 49630573 missense probably benign 0.01
R4700:Flt4 UTSW 11 49626444 intron probably benign
R4701:Flt4 UTSW 11 49626808 missense possibly damaging 0.49
R4714:Flt4 UTSW 11 49627207 missense probably damaging 0.99
R4817:Flt4 UTSW 11 49625415 missense probably damaging 0.98
R4921:Flt4 UTSW 11 49627143 missense probably damaging 0.98
R5066:Flt4 UTSW 11 49634163 missense possibly damaging 0.62
R5095:Flt4 UTSW 11 49627159 missense possibly damaging 0.95
R5166:Flt4 UTSW 11 49633257 splice site probably null
R5245:Flt4 UTSW 11 49651034 frame shift probably null
R5250:Flt4 UTSW 11 49630400 missense possibly damaging 0.88
R5400:Flt4 UTSW 11 49651034 frame shift probably null
R5401:Flt4 UTSW 11 49651034 frame shift probably null
R5402:Flt4 UTSW 11 49651034 frame shift probably null
R5686:Flt4 UTSW 11 49630603 missense probably benign 0.00
R5766:Flt4 UTSW 11 49626686 missense possibly damaging 0.75
R5996:Flt4 UTSW 11 49651070 missense probably damaging 1.00
R6037:Flt4 UTSW 11 49637040 missense probably damaging 1.00
R6037:Flt4 UTSW 11 49637040 missense probably damaging 1.00
R6352:Flt4 UTSW 11 49643506 missense probably benign 0.04
R6361:Flt4 UTSW 11 49630578 missense probably benign 0.00
R6574:Flt4 UTSW 11 49625372 missense probably benign
R7205:Flt4 UTSW 11 49634298 missense probably null 0.78
R7216:Flt4 UTSW 11 49634681 missense possibly damaging 0.73
R7257:Flt4 UTSW 11 49626009 missense probably benign 0.22
R7457:Flt4 UTSW 11 49630328 missense possibly damaging 0.89
R7559:Flt4 UTSW 11 49644371 missense possibly damaging 0.50
X0017:Flt4 UTSW 11 49626733 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- CTAATCTTTCAGCGCCATGC -3'
(R):5'- CTCTGATTGGAGTCTGCCAG -3'

Sequencing Primer
(F):5'- GCTGCACCTATCCCTACTTGAAG -3'
(R):5'- CAGGTCGATTCCTGCAAAAG -3'
Posted On2016-10-05