Incidental Mutation 'R5527:Mroh4'
ID431948
Institutional Source Beutler Lab
Gene Symbol Mroh4
Ensembl Gene ENSMUSG00000022603
Gene Namemaestro heat-like repeat family member 4
Synonyms1700016M24Rik
MMRRC Submission 043085-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5527 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location74606029-74636353 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 74615016 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 342 (I342T)
Ref Sequence ENSEMBL: ENSMUSP00000117011 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023271] [ENSMUST00000137963]
Predicted Effect possibly damaging
Transcript: ENSMUST00000023271
AA Change: I411T

PolyPhen 2 Score 0.826 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000023271
Gene: ENSMUSG00000022603
AA Change: I411T

DomainStartEndE-ValueType
low complexity region 1 12 N/A INTRINSIC
low complexity region 326 337 N/A INTRINSIC
low complexity region 428 435 N/A INTRINSIC
low complexity region 520 534 N/A INTRINSIC
low complexity region 572 591 N/A INTRINSIC
SCOP:d1ee4a_ 709 852 3e-5 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000137963
AA Change: I342T

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000117011
Gene: ENSMUSG00000022603
AA Change: I342T

DomainStartEndE-ValueType
low complexity region 257 268 N/A INTRINSIC
low complexity region 359 366 N/A INTRINSIC
low complexity region 451 465 N/A INTRINSIC
low complexity region 503 522 N/A INTRINSIC
SCOP:d1ee4a_ 640 783 3e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176592
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176767
Coding Region Coverage
  • 1x: 98.2%
  • 3x: 97.2%
  • 10x: 94.9%
  • 20x: 89.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc1 T A 16: 14,460,978 Y1051N probably benign Het
Bach1 T C 16: 87,719,545 S325P probably benign Het
Baz2a T C 10: 128,124,917 S1529P probably damaging Het
BC027072 A T 17: 71,752,640 V14D probably damaging Het
Bicd1 T C 6: 149,494,636 L168P probably damaging Het
Cat A G 2: 103,472,973 F153S probably damaging Het
Ccnt2 T C 1: 127,802,664 M426T probably benign Het
Cdk7 C T 13: 100,730,472 V38I probably damaging Het
Cenpj T C 14: 56,526,983 Y1324C probably damaging Het
Ddx47 C A 6: 135,011,694 A18E probably benign Het
Dnah2 G A 11: 69,437,188 Q3370* probably null Het
Dnah6 C T 6: 73,159,229 V976I probably benign Het
Dock7 C T 4: 98,953,868 probably benign Het
Dpy19l3 A T 7: 35,714,130 I362N possibly damaging Het
Fam118a A T 15: 85,058,798 T343S probably benign Het
Fcgbp T A 7: 28,093,635 D1021E probably benign Het
Fkbp1b T C 12: 4,833,746 Y83C probably damaging Het
Flt4 T C 11: 49,634,754 I709T probably damaging Het
Gga3 G T 11: 115,587,436 A510D probably damaging Het
Heatr1 T C 13: 12,402,760 I264T probably damaging Het
Heatr1 T C 13: 12,404,948 I384T probably benign Het
Hes2 T C 4: 152,160,392 V106A probably benign Het
Igf1r T A 7: 68,207,821 M1083K probably damaging Het
Il7r A T 15: 9,512,924 D166E probably benign Het
Ipo4 G A 14: 55,632,050 probably null Het
Klk1b26 T C 7: 44,012,763 I15T probably benign Het
Krt42 T C 11: 100,263,295 probably benign Het
Lag3 T C 6: 124,908,629 T263A probably damaging Het
Lilra6 T A 7: 3,914,587 probably benign Het
Lrrc31 T A 3: 30,691,228 H90L probably damaging Het
Lvrn G A 18: 46,873,803 D331N probably damaging Het
Me2 A T 18: 73,791,116 W342R probably damaging Het
Mob2 A G 7: 142,009,410 F220S probably damaging Het
Naa15 T C 3: 51,441,947 Y46H probably damaging Het
Neb A G 2: 52,334,453 V10A unknown Het
Nlrc5 A G 8: 94,490,416 H1011R probably damaging Het
Nr1i3 A G 1: 171,214,352 T2A possibly damaging Het
Nrros T C 16: 32,144,470 N207S probably damaging Het
Olfr1356 C T 10: 78,847,775 V47M probably benign Het
Olfr553 A T 7: 102,614,561 S143T probably benign Het
Ptprz1 C T 6: 23,000,053 T714I possibly damaging Het
Rp1 T C 1: 4,346,393 T1499A possibly damaging Het
Rsg1 C A 4: 141,219,992 A228D probably damaging Het
Rubcn T C 16: 32,826,711 K771E probably damaging Het
Sbds T C 5: 130,246,406 E227G possibly damaging Het
Setd1a C T 7: 127,785,629 P8S probably damaging Het
Sh3tc2 A G 18: 62,011,861 I1129V probably benign Het
Spef1 T A 2: 131,172,741 D87V probably damaging Het
Supv3l1 C T 10: 62,429,829 R644Q probably damaging Het
Thoc6 A G 17: 23,670,795 F51S probably damaging Het
Tm4sf19 T C 16: 32,407,921 L176P probably damaging Het
Tma16 A G 8: 66,484,124 I17T possibly damaging Het
Tpd52l2 G A 2: 181,502,054 probably null Het
Ube2j1 C T 4: 33,045,164 P146S probably benign Het
Ubr4 T A 4: 139,480,788 I4960N possibly damaging Het
Usp13 A G 3: 32,865,838 D224G probably damaging Het
Uxs1 T C 1: 43,780,080 T188A probably damaging Het
Vmn2r12 A T 5: 109,086,617 Y576* probably null Het
Vmn2r73 T C 7: 85,858,367 D579G possibly damaging Het
Xpr1 T C 1: 155,290,235 N524D probably benign Het
Xrn2 A T 2: 147,029,755 I366L probably benign Het
Zfp236 A T 18: 82,658,034 V386E possibly damaging Het
Zfp292 A T 4: 34,806,261 L2261Q probably damaging Het
Zpld1 C G 16: 55,226,362 E415Q probably benign Het
Other mutations in Mroh4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01645:Mroh4 APN 15 74611358 splice site probably benign
IGL02370:Mroh4 APN 15 74625541 missense probably benign 0.00
IGL02598:Mroh4 APN 15 74611243 critical splice donor site probably null
IGL02644:Mroh4 APN 15 74610375 missense possibly damaging 0.90
IGL02666:Mroh4 APN 15 74609775 missense probably benign 0.04
IGL02723:Mroh4 APN 15 74608237 splice site probably benign
IGL02724:Mroh4 APN 15 74606151 missense probably benign 0.00
IGL03000:Mroh4 APN 15 74616114 missense probably benign
IGL03103:Mroh4 APN 15 74616159 missense possibly damaging 0.47
IGL03194:Mroh4 APN 15 74611539 missense probably damaging 1.00
R0013:Mroh4 UTSW 15 74608237 splice site probably benign
R0042:Mroh4 UTSW 15 74610305 missense probably damaging 0.99
R0042:Mroh4 UTSW 15 74610305 missense probably damaging 0.99
R0294:Mroh4 UTSW 15 74606149 missense probably benign
R0346:Mroh4 UTSW 15 74614292 splice site probably benign
R0545:Mroh4 UTSW 15 74625427 missense probably benign 0.00
R0688:Mroh4 UTSW 15 74606678 missense probably damaging 0.98
R1838:Mroh4 UTSW 15 74616113 missense probably benign 0.03
R2037:Mroh4 UTSW 15 74609761 missense possibly damaging 0.91
R4725:Mroh4 UTSW 15 74616107 missense probably damaging 0.99
R4786:Mroh4 UTSW 15 74610234 missense probably benign 0.08
R4798:Mroh4 UTSW 15 74626179 missense probably damaging 1.00
R4945:Mroh4 UTSW 15 74612008 missense probably benign 0.00
R5065:Mroh4 UTSW 15 74628270 splice site probably null
R5476:Mroh4 UTSW 15 74611661 missense probably benign 0.15
R5509:Mroh4 UTSW 15 74606154 missense probably benign 0.00
R5662:Mroh4 UTSW 15 74625428 missense possibly damaging 0.63
R5818:Mroh4 UTSW 15 74611982 missense probably damaging 0.98
R5861:Mroh4 UTSW 15 74606607 intron probably benign
R5886:Mroh4 UTSW 15 74606447 missense possibly damaging 0.90
R5935:Mroh4 UTSW 15 74621154 missense probably damaging 1.00
R6008:Mroh4 UTSW 15 74625472 nonsense probably null
R6658:Mroh4 UTSW 15 74621129 missense possibly damaging 0.83
R6689:Mroh4 UTSW 15 74612003 missense probably damaging 1.00
R6739:Mroh4 UTSW 15 74609719 missense probably benign 0.10
R6888:Mroh4 UTSW 15 74613249 missense possibly damaging 0.93
R7088:Mroh4 UTSW 15 74626144 missense probably benign 0.25
R7260:Mroh4 UTSW 15 74608129 missense possibly damaging 0.83
R7365:Mroh4 UTSW 15 74610371 nonsense probably null
R7735:Mroh4 UTSW 15 74625508 missense probably damaging 0.98
R7763:Mroh4 UTSW 15 74624705 missense probably damaging 0.99
Z1177:Mroh4 UTSW 15 74627720 missense probably damaging 1.00
Z1177:Mroh4 UTSW 15 74628002 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- AGGGTGGTCACTCATTGTCTC -3'
(R):5'- CTGCAAACCTTTGTCCATAGC -3'

Sequencing Primer
(F):5'- CTCTGTGATTACATGTGAATGAGAG -3'
(R):5'- GTCCATAGCTCTTACATAACTGTCTG -3'
Posted On2016-10-05