Incidental Mutation 'R5527:Abcc1'
ID431951
Institutional Source Beutler Lab
Gene Symbol Abcc1
Ensembl Gene ENSMUSG00000023088
Gene NameATP-binding cassette, sub-family C (CFTR/MRP), member 1
SynonymsMrp1, Mdrap, MRP, Abcc1b, Abcc1a
MMRRC Submission 043085-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.093) question?
Stock #R5527 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location14361558-14475737 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 14460978 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 1051 (Y1051N)
Ref Sequence ENSEMBL: ENSMUSP00000097743 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100167] [ENSMUST00000130671] [ENSMUST00000133454] [ENSMUST00000147759]
Predicted Effect probably benign
Transcript: ENSMUST00000100167
AA Change: Y1051N

PolyPhen 2 Score 0.184 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000097743
Gene: ENSMUSG00000023088
AA Change: Y1051N

DomainStartEndE-ValueType
transmembrane domain 38 57 N/A INTRINSIC
transmembrane domain 77 94 N/A INTRINSIC
transmembrane domain 104 126 N/A INTRINSIC
transmembrane domain 139 161 N/A INTRINSIC
transmembrane domain 176 198 N/A INTRINSIC
low complexity region 279 290 N/A INTRINSIC
Pfam:ABC_membrane 326 597 7.8e-44 PFAM
AAA 670 845 4.07e-8 SMART
Pfam:ABC_membrane 971 1243 3e-52 PFAM
AAA 1316 1501 5.8e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000130671
SMART Domains Protein: ENSMUSP00000116714
Gene: ENSMUSG00000023088

DomainStartEndE-ValueType
transmembrane domain 38 57 N/A INTRINSIC
transmembrane domain 77 94 N/A INTRINSIC
transmembrane domain 104 126 N/A INTRINSIC
transmembrane domain 139 161 N/A INTRINSIC
transmembrane domain 176 198 N/A INTRINSIC
low complexity region 279 290 N/A INTRINSIC
Pfam:ABC_membrane 326 597 1.6e-48 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000133454
SMART Domains Protein: ENSMUSP00000122656
Gene: ENSMUSG00000023088

DomainStartEndE-ValueType
transmembrane domain 38 57 N/A INTRINSIC
transmembrane domain 77 94 N/A INTRINSIC
transmembrane domain 104 126 N/A INTRINSIC
transmembrane domain 139 161 N/A INTRINSIC
transmembrane domain 176 198 N/A INTRINSIC
low complexity region 279 290 N/A INTRINSIC
Pfam:ABC_membrane 326 597 1.6e-48 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134960
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146032
Predicted Effect probably benign
Transcript: ENSMUST00000147759
SMART Domains Protein: ENSMUSP00000115627
Gene: ENSMUSG00000023088

DomainStartEndE-ValueType
transmembrane domain 38 57 N/A INTRINSIC
transmembrane domain 77 94 N/A INTRINSIC
transmembrane domain 104 126 N/A INTRINSIC
transmembrane domain 139 161 N/A INTRINSIC
transmembrane domain 176 198 N/A INTRINSIC
low complexity region 279 290 N/A INTRINSIC
Pfam:ABC_membrane 326 597 1.6e-48 PFAM
Coding Region Coverage
  • 1x: 98.2%
  • 3x: 97.2%
  • 10x: 94.9%
  • 20x: 89.7%
Validation Efficiency
MGI Phenotype FUNCTION: The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This full transporter is a member of the MRP subfamily which is involved in multi-drug resistance. This protein plays an essential role in the defense against toxic compounds and serves as the major high-affinity transporter of leukotriene C4. The encoded protein may also play an essential role in steroid hormone homeostasis as a transporter for steroid hormones and their metabolites. [provided by RefSeq, Nov 2011]
PHENOTYPE: Mice homozygous for targeted mutations that inactivate the gene have a reduced response to inflammatory stimulus, increased levels of glutathione due to impaired metabolism, and are hypersensitive to the anticancer drug etoposide. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bach1 T C 16: 87,719,545 S325P probably benign Het
Baz2a T C 10: 128,124,917 S1529P probably damaging Het
BC027072 A T 17: 71,752,640 V14D probably damaging Het
Bicd1 T C 6: 149,494,636 L168P probably damaging Het
Cat A G 2: 103,472,973 F153S probably damaging Het
Ccnt2 T C 1: 127,802,664 M426T probably benign Het
Cdk7 C T 13: 100,730,472 V38I probably damaging Het
Cenpj T C 14: 56,526,983 Y1324C probably damaging Het
Ddx47 C A 6: 135,011,694 A18E probably benign Het
Dnah2 G A 11: 69,437,188 Q3370* probably null Het
Dnah6 C T 6: 73,159,229 V976I probably benign Het
Dock7 C T 4: 98,953,868 probably benign Het
Dpy19l3 A T 7: 35,714,130 I362N possibly damaging Het
Fam118a A T 15: 85,058,798 T343S probably benign Het
Fcgbp T A 7: 28,093,635 D1021E probably benign Het
Fkbp1b T C 12: 4,833,746 Y83C probably damaging Het
Flt4 T C 11: 49,634,754 I709T probably damaging Het
Gga3 G T 11: 115,587,436 A510D probably damaging Het
Heatr1 T C 13: 12,402,760 I264T probably damaging Het
Heatr1 T C 13: 12,404,948 I384T probably benign Het
Hes2 T C 4: 152,160,392 V106A probably benign Het
Igf1r T A 7: 68,207,821 M1083K probably damaging Het
Il7r A T 15: 9,512,924 D166E probably benign Het
Ipo4 G A 14: 55,632,050 probably null Het
Klk1b26 T C 7: 44,012,763 I15T probably benign Het
Krt42 T C 11: 100,263,295 probably benign Het
Lag3 T C 6: 124,908,629 T263A probably damaging Het
Lilra6 T A 7: 3,914,587 probably benign Het
Lrrc31 T A 3: 30,691,228 H90L probably damaging Het
Lvrn G A 18: 46,873,803 D331N probably damaging Het
Me2 A T 18: 73,791,116 W342R probably damaging Het
Mob2 A G 7: 142,009,410 F220S probably damaging Het
Mroh4 A G 15: 74,615,016 I342T probably damaging Het
Naa15 T C 3: 51,441,947 Y46H probably damaging Het
Neb A G 2: 52,334,453 V10A unknown Het
Nlrc5 A G 8: 94,490,416 H1011R probably damaging Het
Nr1i3 A G 1: 171,214,352 T2A possibly damaging Het
Nrros T C 16: 32,144,470 N207S probably damaging Het
Olfr1356 C T 10: 78,847,775 V47M probably benign Het
Olfr553 A T 7: 102,614,561 S143T probably benign Het
Ptprz1 C T 6: 23,000,053 T714I possibly damaging Het
Rp1 T C 1: 4,346,393 T1499A possibly damaging Het
Rsg1 C A 4: 141,219,992 A228D probably damaging Het
Rubcn T C 16: 32,826,711 K771E probably damaging Het
Sbds T C 5: 130,246,406 E227G possibly damaging Het
Setd1a C T 7: 127,785,629 P8S probably damaging Het
Sh3tc2 A G 18: 62,011,861 I1129V probably benign Het
Spef1 T A 2: 131,172,741 D87V probably damaging Het
Supv3l1 C T 10: 62,429,829 R644Q probably damaging Het
Thoc6 A G 17: 23,670,795 F51S probably damaging Het
Tm4sf19 T C 16: 32,407,921 L176P probably damaging Het
Tma16 A G 8: 66,484,124 I17T possibly damaging Het
Tpd52l2 G A 2: 181,502,054 probably null Het
Ube2j1 C T 4: 33,045,164 P146S probably benign Het
Ubr4 T A 4: 139,480,788 I4960N possibly damaging Het
Usp13 A G 3: 32,865,838 D224G probably damaging Het
Uxs1 T C 1: 43,780,080 T188A probably damaging Het
Vmn2r12 A T 5: 109,086,617 Y576* probably null Het
Vmn2r73 T C 7: 85,858,367 D579G possibly damaging Het
Xpr1 T C 1: 155,290,235 N524D probably benign Het
Xrn2 A T 2: 147,029,755 I366L probably benign Het
Zfp236 A T 18: 82,658,034 V386E possibly damaging Het
Zfp292 A T 4: 34,806,261 L2261Q probably damaging Het
Zpld1 C G 16: 55,226,362 E415Q probably benign Het
Other mutations in Abcc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Abcc1 APN 16 14460983 missense probably benign 0.34
IGL00094:Abcc1 APN 16 14470534 missense probably null 0.00
IGL00475:Abcc1 APN 16 14436573 missense probably damaging 1.00
IGL00516:Abcc1 APN 16 14413312 nonsense probably null
IGL00765:Abcc1 APN 16 14411508 missense probably damaging 0.99
IGL00792:Abcc1 APN 16 14410926 missense probably benign 0.18
IGL01678:Abcc1 APN 16 14405019 missense probably null 0.96
IGL01683:Abcc1 APN 16 14396424 missense probably damaging 1.00
IGL01955:Abcc1 APN 16 14410795 missense probably damaging 1.00
IGL02048:Abcc1 APN 16 14411519 missense probably damaging 0.98
IGL02345:Abcc1 APN 16 14396351 missense possibly damaging 0.95
IGL02366:Abcc1 APN 16 14467979 splice site probably benign
IGL02431:Abcc1 APN 16 14419734 missense probably damaging 1.00
IGL02480:Abcc1 APN 16 14404005 missense possibly damaging 0.87
IGL02651:Abcc1 APN 16 14466126 missense probably benign 0.00
IGL02902:Abcc1 APN 16 14423127 missense probably damaging 1.00
IGL03101:Abcc1 APN 16 14389868 missense probably damaging 1.00
IGL03230:Abcc1 APN 16 14457947 missense probably benign
IGL03308:Abcc1 APN 16 14470611 missense possibly damaging 0.55
PIT4544001:Abcc1 UTSW 16 14405079 missense probably damaging 1.00
R0310:Abcc1 UTSW 16 14410927 missense probably damaging 0.98
R0594:Abcc1 UTSW 16 14389880 missense probably benign 0.05
R0894:Abcc1 UTSW 16 14465137 missense possibly damaging 0.64
R0928:Abcc1 UTSW 16 14389985 critical splice donor site probably null
R1367:Abcc1 UTSW 16 14443386 missense probably damaging 1.00
R1496:Abcc1 UTSW 16 14448434 missense probably damaging 1.00
R1643:Abcc1 UTSW 16 14413368 missense probably damaging 1.00
R1795:Abcc1 UTSW 16 14465137 missense possibly damaging 0.64
R1834:Abcc1 UTSW 16 14423117 missense possibly damaging 0.88
R1847:Abcc1 UTSW 16 14445449 missense probably benign 0.02
R1959:Abcc1 UTSW 16 14396393 missense probably damaging 1.00
R1961:Abcc1 UTSW 16 14396393 missense probably damaging 1.00
R2017:Abcc1 UTSW 16 14461204 missense probably damaging 1.00
R2224:Abcc1 UTSW 16 14472068 missense probably damaging 1.00
R2377:Abcc1 UTSW 16 14467923 missense probably damaging 0.97
R2513:Abcc1 UTSW 16 14473009 splice site probably null
R2876:Abcc1 UTSW 16 14457960 missense probably benign
R3003:Abcc1 UTSW 16 14436529 missense probably damaging 1.00
R3941:Abcc1 UTSW 16 14396399 missense probably benign 0.00
R4119:Abcc1 UTSW 16 14394013 missense probably benign 0.43
R4191:Abcc1 UTSW 16 14389864 missense probably damaging 1.00
R4369:Abcc1 UTSW 16 14460993 missense possibly damaging 0.88
R4428:Abcc1 UTSW 16 14445300 missense probably damaging 0.97
R4589:Abcc1 UTSW 16 14394031 missense probably benign 0.00
R4779:Abcc1 UTSW 16 14410771 missense probably benign 0.35
R5027:Abcc1 UTSW 16 14404053 critical splice donor site probably null
R5275:Abcc1 UTSW 16 14466186 missense probably damaging 1.00
R5418:Abcc1 UTSW 16 14461132 missense probably benign 0.02
R5490:Abcc1 UTSW 16 14410917 missense probably damaging 1.00
R5641:Abcc1 UTSW 16 14472013 missense probably benign 0.00
R5642:Abcc1 UTSW 16 14443455 missense probably damaging 1.00
R5875:Abcc1 UTSW 16 14467037 missense possibly damaging 0.94
R5916:Abcc1 UTSW 16 14465142 missense possibly damaging 0.95
R6112:Abcc1 UTSW 16 14460916 missense probably damaging 1.00
R6331:Abcc1 UTSW 16 14465056 missense probably damaging 0.97
R6464:Abcc1 UTSW 16 14447490 missense probably damaging 1.00
R6950:Abcc1 UTSW 16 14411616 missense probably damaging 1.00
R7024:Abcc1 UTSW 16 14413383 critical splice donor site probably null
R7115:Abcc1 UTSW 16 14437725 missense probably benign 0.11
R7187:Abcc1 UTSW 16 14466997 missense probably benign
R7298:Abcc1 UTSW 16 14396472 missense possibly damaging 0.89
R7342:Abcc1 UTSW 16 14465169 missense probably damaging 0.99
R7474:Abcc1 UTSW 16 14472986 missense possibly damaging 0.95
R7488:Abcc1 UTSW 16 14389899 nonsense probably null
R7583:Abcc1 UTSW 16 14404038 missense probably damaging 1.00
R7619:Abcc1 UTSW 16 14445419 missense probably damaging 0.96
R7971:Abcc1 UTSW 16 14448579 missense probably benign
R8048:Abcc1 UTSW 16 14410844 missense probably damaging 1.00
R8138:Abcc1 UTSW 16 14472887 missense probably damaging 0.99
R8159:Abcc1 UTSW 16 14472930 missense probably damaging 0.96
R8319:Abcc1 UTSW 16 14396451 missense probably damaging 1.00
X0026:Abcc1 UTSW 16 14459902 missense possibly damaging 0.94
Z1088:Abcc1 UTSW 16 14410809 missense probably benign 0.01
Z1177:Abcc1 UTSW 16 14411493 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CACATAGCATCAGCATCTGC -3'
(R):5'- AGTAGGATGATGATGACAGCTC -3'

Sequencing Primer
(F):5'- TGGTACAGTAACTGCTAGCCATG -3'
(R):5'- TGATGATGACAGCTCCAATGAC -3'
Posted On2016-10-05