Incidental Mutation 'R0478:Epgn'
ID43196
Institutional Source Beutler Lab
Gene Symbol Epgn
Ensembl Gene ENSMUSG00000035020
Gene Nameepithelial mitogen
Synonyms2310069M11Rik, epigen
MMRRC Submission 038678-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0478 (G1)
Quality Score194
Status Validated
Chromosome5
Chromosomal Location91027464-91035215 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 91031128 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 36 (V36L)
Ref Sequence ENSEMBL: ENSMUSP00000144500 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041516] [ENSMUST00000202724]
Predicted Effect probably benign
Transcript: ENSMUST00000041516
AA Change: V51L

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000046987
Gene: ENSMUSG00000035020
AA Change: V51L

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
EGF 58 95 1.01e-1 SMART
transmembrane domain 110 132 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000202724
AA Change: V36L

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000144500
Gene: ENSMUSG00000035020
AA Change: V36L

DomainStartEndE-ValueType
EGF 43 80 5.1e-4 SMART
transmembrane domain 95 117 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.0%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 100% (49/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the epidermal growth factor family. Members of this family are ligands for the epidermal growth factor receptor and play a role in cell survival, proliferation and migration. This protein has been reported to have high mitogenic activity but low affinity for its receptor. Expression of this transcript and protein have been reported in cancer specimens of the breast, bladder, and prostate. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit moderate increase in absolute pancreas and spleen weight but normal epidermis and pilosebaceous unit development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432E11Rik A T 7: 29,562,589 noncoding transcript Het
4930556J24Rik T G 11: 3,976,259 probably benign Het
Acnat1 T G 4: 49,450,901 D70A probably damaging Het
Adnp2 A G 18: 80,129,334 V620A probably benign Het
Aldoart1 T A 4: 72,852,343 H21L probably benign Het
Birc3 A G 9: 7,860,347 V290A probably damaging Het
Bpifb3 C T 2: 153,931,480 probably benign Het
Camta1 C A 4: 151,075,140 R1614L probably damaging Het
Clmn A G 12: 104,785,491 M235T probably damaging Het
Dmbt1 A G 7: 131,041,187 E245G possibly damaging Het
Ets2 C A 16: 95,716,262 P346Q probably damaging Het
Fam222b T C 11: 78,153,856 L81P probably damaging Het
Fancf A C 7: 51,861,692 L188R probably damaging Het
Fibin T C 2: 110,362,734 D21G possibly damaging Het
Fzd6 A G 15: 39,034,034 probably null Het
Gbp4 T A 5: 105,119,433 Q540L probably benign Het
Greb1l T A 18: 10,509,281 L531Q probably damaging Het
Il5ra A G 6: 106,738,462 V137A probably benign Het
Kif26a G A 12: 112,175,789 A826T probably damaging Het
Kiz T C 2: 146,942,158 V537A possibly damaging Het
Klhl32 C T 4: 24,792,777 G15D probably damaging Het
Kmt2d G A 15: 98,853,581 probably benign Het
Lbp T C 2: 158,317,528 probably benign Het
Mmp25 T C 17: 23,632,782 T318A probably benign Het
Mrpl50 A G 4: 49,514,513 C53R probably damaging Het
Msl3l2 G C 10: 56,115,315 E45D probably damaging Het
Nfxl1 A G 5: 72,524,645 probably null Het
Noc3l A G 19: 38,810,006 probably null Het
Olfr1126 T A 2: 87,458,026 V287E probably damaging Het
Olfr1375 T C 11: 51,048,712 S202P probably benign Het
Pgm5 A T 19: 24,834,869 S100T possibly damaging Het
Pi4ka C T 16: 17,309,311 G1093S possibly damaging Het
Pitrm1 T A 13: 6,559,395 S350T probably damaging Het
Ptk2b G T 14: 66,213,372 N48K probably damaging Het
Sept3 T C 15: 82,290,806 L172P probably damaging Het
Sirt3 A T 7: 140,878,114 C41S probably benign Het
Sphkap C T 1: 83,278,711 R152H probably damaging Het
St3gal1 T C 15: 67,113,730 Y25C probably damaging Het
Tbc1d31 T C 15: 57,932,536 F175S probably damaging Het
Tfdp2 T A 9: 96,290,583 D43E probably benign Het
Tgm1 G A 14: 55,700,334 Q773* probably null Het
Tmc3 A T 7: 83,622,152 R837S possibly damaging Het
Unc13a A G 8: 71,651,148 V880A possibly damaging Het
Vmn1r237 T A 17: 21,314,819 V268E probably damaging Het
Zan C T 5: 137,400,526 probably benign Het
Zfp760 G T 17: 21,722,014 E57* probably null Het
Other mutations in Epgn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02090:Epgn APN 5 91033957 missense probably damaging 0.99
R0309:Epgn UTSW 5 91032214 missense probably benign 0.06
R1034:Epgn UTSW 5 91032221 missense probably damaging 1.00
R4551:Epgn UTSW 5 91027562 nonsense probably null
R4552:Epgn UTSW 5 91027562 nonsense probably null
R4553:Epgn UTSW 5 91027562 nonsense probably null
R4997:Epgn UTSW 5 91032239 missense possibly damaging 0.58
R5177:Epgn UTSW 5 91028277 start gained probably benign
R5754:Epgn UTSW 5 91033948 missense probably benign 0.09
R5881:Epgn UTSW 5 91028363 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- CCAATGCTGCCACCTTTTGACCAAC -3'
(R):5'- TTGCAACTGTGCTGTGTGCATCCC -3'

Sequencing Primer
(F):5'- CCACTCTATAACTAACCGATAATGTG -3'
(R):5'- CCTTCTCCCATGTCTAAGACTTG -3'
Posted On2013-05-23