Mutagenetix > Incidental Mutations

Incidental Mutation 'R5527:Sh3tc2'

431961

Institutional Source

Beutler Lab

Gene Symbol

Sh3tc2

Ensembl Gene

ENSMUSG00000045629

Gene Name

SH3 domain and tetratricopeptide repeats 2

Synonyms

D430044G18Rik

MMRRC Submission

043085-MU

Accession Numbers

Genbank: NM_172628

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5527 (G1)

Quality Score

167

Status

Not validated

Chromosome

Chromosomal Location

61953075-62015715 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 62011861 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 1129 (I1129V)

Ref Sequence

ENSEMBL: ENSMUSP00000055094 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000051720]

Predicted Effect

probably benign
Transcript: ENSMUST00000051720
AA Change: I1129V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000055094
Gene: ENSMUSG00000045629
AA Change: I1129V

Domain	Start	End	E-Value	Type
coiled coil region	75	101	N/A	INTRINSIC
SH3	179	238	1.02e0	SMART
SH3	270	329	6.76e-5	SMART
low complexity region	414	425	N/A	INTRINSIC
low complexity region	441	452	N/A	INTRINSIC
low complexity region	486	503	N/A	INTRINSIC
TPR	529	562	3.24e1	SMART
low complexity region	568	581	N/A	INTRINSIC
TPR	837	870	2.66e0	SMART
Blast:TPR	877	910	2e-7	BLAST
low complexity region	1011	1025	N/A	INTRINSIC
Blast:TPR	1045	1078	1e-12	BLAST
Blast:TPR	1127	1158	3e-7	BLAST
TPR	1167	1200	1.04e-2	SMART
Blast:TPR	1211	1235	5e-7	BLAST

Coding Region Coverage

1x: 98.2%
3x: 97.2%
10x: 94.9%
20x: 89.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with two N-terminal Src homology 3 (SH3) domains and 10 tetratricopeptide repeat (TPR) motifs, and is a member of a small gene family. The gene product has been proposed to be an adapter or docking molecule. Mutations in this gene result in autosomal recessive Charcot-Marie-Tooth disease type 4C, a childhood-onset neurodegenerative disease characterized by demyelination of motor and sensory neurons. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit hypomyelination of peripheral axons with reduced conduction velocity and limb grasping. [provided by MGI curators]

Allele List at MGI

All alleles(3) : Targeted, other(3)

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc1	T	A	16: 14,460,978	Y1051N	probably benign	Het
Bach1	T	C	16: 87,719,545	S325P	probably benign	Het
Baz2a	T	C	10: 128,124,917	S1529P	probably damaging	Het
BC027072	A	T	17: 71,752,640	V14D	probably damaging	Het
Bicd1	T	C	6: 149,494,636	L168P	probably damaging	Het
Cat	A	G	2: 103,472,973	F153S	probably damaging	Het
Ccnt2	T	C	1: 127,802,664	M426T	probably benign	Het
Cdk7	C	T	13: 100,730,472	V38I	probably damaging	Het
Cenpj	T	C	14: 56,526,983	Y1324C	probably damaging	Het
Ddx47	C	A	6: 135,011,694	A18E	probably benign	Het
Dnah2	G	A	11: 69,437,188	Q3370*	probably null	Het
Dnah6	C	T	6: 73,159,229	V976I	probably benign	Het
Dock7	C	T	4: 98,953,868		probably benign	Het
Dpy19l3	A	T	7: 35,714,130	I362N	possibly damaging	Het
Fam118a	A	T	15: 85,058,798	T343S	probably benign	Het
Fcgbp	T	A	7: 28,093,635	D1021E	probably benign	Het
Fkbp1b	T	C	12: 4,833,746	Y83C	probably damaging	Het
Flt4	T	C	11: 49,634,754	I709T	probably damaging	Het
Gga3	G	T	11: 115,587,436	A510D	probably damaging	Het
Heatr1	T	C	13: 12,402,760	I264T	probably damaging	Het
Heatr1	T	C	13: 12,404,948	I384T	probably benign	Het
Hes2	T	C	4: 152,160,392	V106A	probably benign	Het
Igf1r	T	A	7: 68,207,821	M1083K	probably damaging	Het
Il7r	A	T	15: 9,512,924	D166E	probably benign	Het
Ipo4	G	A	14: 55,632,050		probably null	Het
Klk1b26	T	C	7: 44,012,763	I15T	probably benign	Het
Krt42	T	C	11: 100,263,295		probably benign	Het
Lag3	T	C	6: 124,908,629	T263A	probably damaging	Het
Lilra6	T	A	7: 3,914,587		probably benign	Het
Lrrc31	T	A	3: 30,691,228	H90L	probably damaging	Het
Lvrn	G	A	18: 46,873,803	D331N	probably damaging	Het
Me2	A	T	18: 73,791,116	W342R	probably damaging	Het
Mob2	A	G	7: 142,009,410	F220S	probably damaging	Het
Mroh4	A	G	15: 74,615,016	I342T	probably damaging	Het
Naa15	T	C	3: 51,441,947	Y46H	probably damaging	Het
Neb	A	G	2: 52,334,453	V10A	unknown	Het
Nlrc5	A	G	8: 94,490,416	H1011R	probably damaging	Het
Nr1i3	A	G	1: 171,214,352	T2A	possibly damaging	Het
Nrros	T	C	16: 32,144,470	N207S	probably damaging	Het
Olfr1356	C	T	10: 78,847,775	V47M	probably benign	Het
Olfr553	A	T	7: 102,614,561	S143T	probably benign	Het
Ptprz1	C	T	6: 23,000,053	T714I	possibly damaging	Het
Rp1	T	C	1: 4,346,393	T1499A	possibly damaging	Het
Rsg1	C	A	4: 141,219,992	A228D	probably damaging	Het
Rubcn	T	C	16: 32,826,711	K771E	probably damaging	Het
Sbds	T	C	5: 130,246,406	E227G	possibly damaging	Het
Setd1a	C	T	7: 127,785,629	P8S	probably damaging	Het
Spef1	T	A	2: 131,172,741	D87V	probably damaging	Het
Supv3l1	C	T	10: 62,429,829	R644Q	probably damaging	Het
Thoc6	A	G	17: 23,670,795	F51S	probably damaging	Het
Tm4sf19	T	C	16: 32,407,921	L176P	probably damaging	Het
Tma16	A	G	8: 66,484,124	I17T	possibly damaging	Het
Tpd52l2	G	A	2: 181,502,054		probably null	Het
Ube2j1	C	T	4: 33,045,164	P146S	probably benign	Het
Ubr4	T	A	4: 139,480,788	I4960N	possibly damaging	Het
Usp13	A	G	3: 32,865,838	D224G	probably damaging	Het
Uxs1	T	C	1: 43,780,080	T188A	probably damaging	Het
Vmn2r12	A	T	5: 109,086,617	Y576*	probably null	Het
Vmn2r73	T	C	7: 85,858,367	D579G	possibly damaging	Het
Xpr1	T	C	1: 155,290,235	N524D	probably benign	Het
Xrn2	A	T	2: 147,029,755	I366L	probably benign	Het
Zfp236	A	T	18: 82,658,034	V386E	possibly damaging	Het
Zfp292	A	T	4: 34,806,261	L2261Q	probably damaging	Het
Zpld1	C	G	16: 55,226,362	E415Q	probably benign	Het

Other mutations in Sh3tc2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01146:Sh3tc2	APN	18	61989511	missense	probably damaging	1.00
IGL01523:Sh3tc2	APN	18	61990883	missense	probably benign	0.00
IGL02036:Sh3tc2	APN	18	62014907	missense	probably benign	0.17
IGL02189:Sh3tc2	APN	18	61990622	missense	probably benign	0.00
IGL02555:Sh3tc2	APN	18	61990237	missense	probably damaging	0.99
IGL02827:Sh3tc2	APN	18	62013159	missense	probably benign	0.34
IGL03033:Sh3tc2	APN	18	61974478	missense	possibly damaging	0.90
IGL03040:Sh3tc2	APN	18	61989410	missense	probably benign	0.00
IGL03062:Sh3tc2	APN	18	62011880	missense	probably damaging	1.00
IGL03386:Sh3tc2	APN	18	61973311	missense	probably benign	0.39
3-1:Sh3tc2	UTSW	18	61991138	missense	probably damaging	1.00
R1085:Sh3tc2	UTSW	18	62014996	missense	probably benign	0.01
R1166:Sh3tc2	UTSW	18	61991176	missense	probably damaging	0.99
R1182:Sh3tc2	UTSW	18	61968100	missense	probably benign	0.17
R1521:Sh3tc2	UTSW	18	62008488	missense	probably damaging	0.96
R1636:Sh3tc2	UTSW	18	61989721	missense	probably damaging	0.98
R1872:Sh3tc2	UTSW	18	62011883	missense	probably damaging	1.00
R1884:Sh3tc2	UTSW	18	62008575	missense	probably damaging	1.00
R1964:Sh3tc2	UTSW	18	61991155	nonsense	probably null
R2034:Sh3tc2	UTSW	18	61987666	missense	probably damaging	1.00
R2046:Sh3tc2	UTSW	18	61990843	missense	probably benign
R2113:Sh3tc2	UTSW	18	62013105	missense	probably damaging	1.00
R2363:Sh3tc2	UTSW	18	61990895	missense	probably benign	0.07
R2940:Sh3tc2	UTSW	18	61989686	missense	probably damaging	1.00
R2979:Sh3tc2	UTSW	18	61989485	missense	probably damaging	1.00
R3717:Sh3tc2	UTSW	18	61990343	missense	probably benign	0.04
R3718:Sh3tc2	UTSW	18	61990343	missense	probably benign	0.04
R4334:Sh3tc2	UTSW	18	61990321	missense	probably damaging	1.00
R4454:Sh3tc2	UTSW	18	62007773	missense	probably damaging	1.00
R4503:Sh3tc2	UTSW	18	61974623	missense	probably damaging	0.96
R4515:Sh3tc2	UTSW	18	61987693	splice site	probably null
R4659:Sh3tc2	UTSW	18	61974509	missense	probably benign	0.00
R4859:Sh3tc2	UTSW	18	62013093	missense	probably benign	0.00
R4901:Sh3tc2	UTSW	18	61990435	missense	probably benign	0.03
R5033:Sh3tc2	UTSW	18	62014891	splice site	probably null
R5269:Sh3tc2	UTSW	18	61975613	missense	probably benign	0.00
R5439:Sh3tc2	UTSW	18	61989633	nonsense	probably null
R5467:Sh3tc2	UTSW	18	61990688	missense	possibly damaging	0.81
R5468:Sh3tc2	UTSW	18	61973431	critical splice donor site	probably null
R5829:Sh3tc2	UTSW	18	61990915	missense	probably benign	0.19
R5880:Sh3tc2	UTSW	18	61973311	missense	probably benign	0.39
R5948:Sh3tc2	UTSW	18	62013105	missense	probably damaging	1.00
R5951:Sh3tc2	UTSW	18	61990007	missense	probably damaging	1.00
R5973:Sh3tc2	UTSW	18	61977904	missense	probably benign	0.06
R5995:Sh3tc2	UTSW	18	61990010	missense	probably damaging	0.96
R6309:Sh3tc2	UTSW	18	61968010	missense	probably damaging	0.98
R6339:Sh3tc2	UTSW	18	61975571	nonsense	probably null
R6648:Sh3tc2	UTSW	18	62015040	missense	probably benign	0.00
R6723:Sh3tc2	UTSW	18	61977954	missense	probably damaging	1.00
R6752:Sh3tc2	UTSW	18	61961037	missense	probably benign	0.00
R7211:Sh3tc2	UTSW	18	61989403	missense	probably benign
R7367:Sh3tc2	UTSW	18	61989506	missense	probably benign	0.00
R7664:Sh3tc2	UTSW	18	62014971	nonsense	probably null
R7727:Sh3tc2	UTSW	18	61989580	missense	probably benign	0.02
R7823:Sh3tc2	UTSW	18	61953117	start codon destroyed	probably null	1.00
R8191:Sh3tc2	UTSW	18	61973358	missense	probably damaging	1.00
R8204:Sh3tc2	UTSW	18	61953129	missense	probably damaging	1.00
R8219:Sh3tc2	UTSW	18	62011861	missense	probably benign	0.00
R8260:Sh3tc2	UTSW	18	62013066	missense	probably damaging	1.00
R8413:Sh3tc2	UTSW	18	61990802	missense	probably damaging	1.00
R8413:Sh3tc2	UTSW	18	62015071	missense	probably benign	0.30
Z1176:Sh3tc2	UTSW	18	61989909	nonsense	probably null
Z1177:Sh3tc2	UTSW	18	61989688	missense	probably damaging	1.00
Z1177:Sh3tc2	UTSW	18	61991318	missense	probably benign	0.09
Z1177:Sh3tc2	UTSW	18	62014991	missense	probably damaging	0.96

Predicted Primers

PCR Primer
(F):5'- CTAGCTACATCTGGGCAGAGTAC -3'
(R):5'- GCACAACCCTAGTTCAAAGCTG -3'

Sequencing Primer
(F):5'- CTACATCTGGGCAGAGTACCAAGAG -3'
(R):5'- TAGTTCAAAGCTGGCGTCCAC -3'

Posted On

2016-10-05