Incidental Mutation 'R5489:Aqr'
ID 431965
Institutional Source Beutler Lab
Gene Symbol Aqr
Ensembl Gene ENSMUSG00000040383
Gene Name aquarius
Synonyms
MMRRC Submission 043050-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R5489 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 113931642-114005788 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 113963554 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 632 (N632S)
Ref Sequence ENSEMBL: ENSMUSP00000047157 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043160] [ENSMUST00000102543]
AlphaFold Q8CFQ3
Predicted Effect probably damaging
Transcript: ENSMUST00000043160
AA Change: N632S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000047157
Gene: ENSMUSG00000040383
AA Change: N632S

DomainStartEndE-ValueType
Pfam:Aquarius_N 18 802 N/A PFAM
Pfam:ResIII 797 911 8.2e-7 PFAM
Pfam:AAA_11 801 1111 9.6e-32 PFAM
Pfam:AAA_19 807 894 3.7e-11 PFAM
Pfam:AAA_12 1119 1312 2.1e-27 PFAM
low complexity region 1394 1417 N/A INTRINSIC
low complexity region 1455 1468 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000102543
AA Change: N632S

PolyPhen 2 Score 0.660 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000099602
Gene: ENSMUSG00000040383
AA Change: N632S

DomainStartEndE-ValueType
low complexity region 43 56 N/A INTRINSIC
low complexity region 112 124 N/A INTRINSIC
low complexity region 762 776 N/A INTRINSIC
Pfam:AAA_11 801 1111 3.2e-32 PFAM
Pfam:AAA_19 807 893 6.5e-11 PFAM
Pfam:AAA_12 1119 1312 2.6e-27 PFAM
low complexity region 1348 1359 N/A INTRINSIC
low complexity region 1371 1382 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125460
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126701
Meta Mutation Damage Score 0.0837 question?
Coding Region Coverage
  • 1x: 98.4%
  • 3x: 97.4%
  • 10x: 95.4%
  • 20x: 91.6%
Validation Efficiency 95% (57/60)
MGI Phenotype PHENOTYPE: Homozygotes for a targeted null mutation exhibit severe defects in placental vascularization with few vessels entering the placenta and little branching. Mutants die between embryonic days 9.5 and 10.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730455P16Rik A T 11: 80,268,778 (GRCm39) M1K probably null Het
Abca14 T A 7: 119,851,473 (GRCm39) V817D probably damaging Het
Bms1 T C 6: 118,390,706 (GRCm39) T208A possibly damaging Het
Brd8 A T 18: 34,741,698 (GRCm39) probably null Het
Caln1 G T 5: 130,443,673 (GRCm39) R2L possibly damaging Het
Cdk17 A G 10: 93,068,274 (GRCm39) T344A probably damaging Het
Chd8 A T 14: 52,450,505 (GRCm39) probably benign Het
Clec14a A G 12: 58,315,035 (GRCm39) F196L probably damaging Het
Clec2f T C 6: 128,997,449 (GRCm39) noncoding transcript Het
Col4a1 A T 8: 11,362,550 (GRCm39) probably benign Het
Col9a3 G A 2: 180,258,318 (GRCm39) R579H probably damaging Het
Cyb561 A G 11: 105,826,349 (GRCm39) V202A probably benign Het
Cyp2c69 T G 19: 39,839,603 (GRCm39) Q340P probably null Het
D630003M21Rik T A 2: 158,058,941 (GRCm39) T320S probably benign Het
D630045J12Rik A T 6: 38,173,782 (GRCm39) S129T possibly damaging Het
Ddx54 A G 5: 120,762,786 (GRCm39) T636A probably benign Het
Dnah8 T G 17: 31,009,930 (GRCm39) F3774V probably damaging Het
Ern1 A G 11: 106,298,355 (GRCm39) S674P probably damaging Het
Fam13a A T 6: 59,001,303 (GRCm39) L8Q probably null Het
Fam83b T C 9: 76,452,881 (GRCm39) N62S probably benign Het
Foxred1 A T 9: 35,121,266 (GRCm39) V94E probably damaging Het
Frmd8 T A 19: 5,902,680 (GRCm39) Q457L probably damaging Het
Gvin3 T A 7: 106,200,797 (GRCm39) noncoding transcript Het
Heatr6 A G 11: 83,665,258 (GRCm39) E741G probably damaging Het
Hnrnpab A G 11: 51,495,640 (GRCm39) L133S probably damaging Het
Itga2 A T 13: 114,979,971 (GRCm39) W1077R probably damaging Het
Kat6b A G 14: 21,719,332 (GRCm39) D1228G probably damaging Het
Klk14 G A 7: 43,341,501 (GRCm39) C51Y probably damaging Het
Kmt2a A T 9: 44,752,335 (GRCm39) probably benign Het
Leap2 T G 11: 53,313,240 (GRCm39) *77C probably null Het
Mmp20 A G 9: 7,643,958 (GRCm39) probably null Het
Mrps9 T G 1: 42,937,593 (GRCm39) probably benign Het
Muc2 T C 7: 141,305,169 (GRCm39) S158P probably benign Het
Mus81 T C 19: 5,537,917 (GRCm39) probably benign Het
Nrip3 T C 7: 109,361,045 (GRCm39) T210A probably damaging Het
Or52s1b T C 7: 102,822,658 (GRCm39) Y62C probably damaging Het
Padi2 T C 4: 140,671,799 (GRCm39) F509S probably damaging Het
Pcdha12 A G 18: 37,155,260 (GRCm39) T660A probably benign Het
Pdzd2 G A 15: 12,382,762 (GRCm39) P1197L probably benign Het
Rec8 A T 14: 55,860,283 (GRCm39) Q291L probably benign Het
Robo4 CGG CG 9: 37,322,786 (GRCm39) probably null Het
Sart3 A G 5: 113,909,441 (GRCm39) W86R probably damaging Het
Slc17a4 A G 13: 24,082,825 (GRCm39) probably null Het
Tdpoz1 T A 3: 93,577,974 (GRCm39) Y270F possibly damaging Het
Thap3 T A 4: 152,070,109 (GRCm39) probably benign Het
Tmem45a T A 16: 56,646,074 (GRCm39) probably null Het
Trim43a A T 9: 88,464,229 (GRCm39) I47F probably damaging Het
Vps13b A T 15: 35,770,688 (GRCm39) I2044L probably benign Het
Zfp735 G A 11: 73,601,419 (GRCm39) W121* probably null Het
Zmym2 A G 14: 57,193,712 (GRCm39) K1176E possibly damaging Het
Other mutations in Aqr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00572:Aqr APN 2 113,956,423 (GRCm39) missense possibly damaging 0.90
IGL00694:Aqr APN 2 113,982,006 (GRCm39) missense probably damaging 1.00
IGL02113:Aqr APN 2 113,950,508 (GRCm39) nonsense probably null
IGL02297:Aqr APN 2 113,980,962 (GRCm39) missense probably benign 0.24
IGL02380:Aqr APN 2 113,940,417 (GRCm39) missense probably damaging 1.00
IGL02410:Aqr APN 2 113,967,398 (GRCm39) missense possibly damaging 0.85
IGL02413:Aqr APN 2 113,949,261 (GRCm39) missense possibly damaging 0.87
IGL02474:Aqr APN 2 113,943,127 (GRCm39) missense probably damaging 1.00
IGL02941:Aqr APN 2 113,943,835 (GRCm39) missense probably damaging 1.00
IGL02981:Aqr APN 2 113,965,305 (GRCm39) splice site probably benign
IGL03001:Aqr APN 2 113,977,400 (GRCm39) missense probably benign
IGL03092:Aqr APN 2 113,989,424 (GRCm39) missense probably benign 0.38
IGL03222:Aqr APN 2 113,951,737 (GRCm39) missense probably damaging 1.00
capricorn UTSW 2 113,936,363 (GRCm39) missense probably damaging 1.00
Goat UTSW 2 113,988,056 (GRCm39) missense probably damaging 1.00
Pliades UTSW 2 113,963,457 (GRCm39) missense probably damaging 1.00
sagittarius UTSW 2 113,979,497 (GRCm39) missense probably damaging 1.00
Zodiac UTSW 2 113,938,590 (GRCm39) missense probably damaging 0.96
PIT4531001:Aqr UTSW 2 113,961,215 (GRCm39) missense possibly damaging 0.94
R0103:Aqr UTSW 2 113,979,497 (GRCm39) missense probably damaging 1.00
R0103:Aqr UTSW 2 113,979,497 (GRCm39) missense probably damaging 1.00
R0152:Aqr UTSW 2 113,989,491 (GRCm39) missense probably benign 0.07
R0352:Aqr UTSW 2 114,000,533 (GRCm39) missense probably damaging 1.00
R0371:Aqr UTSW 2 113,988,085 (GRCm39) missense possibly damaging 0.80
R0374:Aqr UTSW 2 113,961,092 (GRCm39) missense probably damaging 1.00
R0550:Aqr UTSW 2 113,963,457 (GRCm39) missense probably damaging 1.00
R0604:Aqr UTSW 2 113,961,085 (GRCm39) missense probably benign 0.00
R0685:Aqr UTSW 2 113,971,458 (GRCm39) missense probably damaging 1.00
R1236:Aqr UTSW 2 113,947,136 (GRCm39) missense probably damaging 1.00
R1434:Aqr UTSW 2 113,980,890 (GRCm39) missense probably damaging 1.00
R1806:Aqr UTSW 2 113,992,133 (GRCm39) missense probably damaging 1.00
R2154:Aqr UTSW 2 113,967,485 (GRCm39) missense probably damaging 1.00
R2185:Aqr UTSW 2 113,961,015 (GRCm39) critical splice donor site probably null
R2377:Aqr UTSW 2 113,971,421 (GRCm39) missense possibly damaging 0.58
R2862:Aqr UTSW 2 113,967,398 (GRCm39) missense probably damaging 1.00
R3615:Aqr UTSW 2 113,967,368 (GRCm39) missense probably damaging 1.00
R3616:Aqr UTSW 2 113,967,368 (GRCm39) missense probably damaging 1.00
R3713:Aqr UTSW 2 113,949,150 (GRCm39) splice site probably benign
R3715:Aqr UTSW 2 113,949,150 (GRCm39) splice site probably benign
R4586:Aqr UTSW 2 113,943,058 (GRCm39) missense probably benign 0.06
R4663:Aqr UTSW 2 113,992,147 (GRCm39) nonsense probably null
R4809:Aqr UTSW 2 114,005,695 (GRCm39) utr 5 prime probably benign
R4887:Aqr UTSW 2 113,980,990 (GRCm39) missense probably damaging 1.00
R4888:Aqr UTSW 2 113,980,990 (GRCm39) missense probably damaging 1.00
R4952:Aqr UTSW 2 113,940,418 (GRCm39) missense probably damaging 1.00
R4974:Aqr UTSW 2 113,943,832 (GRCm39) missense probably damaging 1.00
R5050:Aqr UTSW 2 114,000,506 (GRCm39) critical splice donor site probably null
R5050:Aqr UTSW 2 113,943,090 (GRCm39) nonsense probably null
R5213:Aqr UTSW 2 113,943,808 (GRCm39) missense probably damaging 1.00
R5263:Aqr UTSW 2 113,947,059 (GRCm39) missense probably damaging 1.00
R5470:Aqr UTSW 2 113,988,056 (GRCm39) missense probably damaging 1.00
R5488:Aqr UTSW 2 113,963,554 (GRCm39) missense probably damaging 1.00
R5567:Aqr UTSW 2 113,979,451 (GRCm39) missense probably damaging 1.00
R5570:Aqr UTSW 2 113,979,451 (GRCm39) missense probably damaging 1.00
R5641:Aqr UTSW 2 113,979,515 (GRCm39) missense probably damaging 1.00
R5685:Aqr UTSW 2 113,986,746 (GRCm39) missense possibly damaging 0.87
R5963:Aqr UTSW 2 113,957,442 (GRCm39) missense probably damaging 1.00
R5992:Aqr UTSW 2 113,973,530 (GRCm39) nonsense probably null
R6015:Aqr UTSW 2 114,005,646 (GRCm39) start codon destroyed probably null 0.53
R6253:Aqr UTSW 2 113,986,758 (GRCm39) missense possibly damaging 0.93
R6264:Aqr UTSW 2 113,940,445 (GRCm39) missense probably damaging 1.00
R6773:Aqr UTSW 2 113,979,477 (GRCm39) missense possibly damaging 0.64
R6877:Aqr UTSW 2 113,947,052 (GRCm39) nonsense probably null
R7211:Aqr UTSW 2 113,965,204 (GRCm39) missense probably benign 0.01
R7232:Aqr UTSW 2 113,936,363 (GRCm39) missense probably damaging 1.00
R7308:Aqr UTSW 2 113,934,543 (GRCm39) missense possibly damaging 0.86
R7396:Aqr UTSW 2 113,950,427 (GRCm39) nonsense probably null
R7490:Aqr UTSW 2 113,989,349 (GRCm39) critical splice donor site probably null
R7526:Aqr UTSW 2 113,938,590 (GRCm39) missense probably damaging 0.96
R7629:Aqr UTSW 2 113,945,074 (GRCm39) missense probably damaging 1.00
R7828:Aqr UTSW 2 113,979,497 (GRCm39) missense probably damaging 1.00
R8037:Aqr UTSW 2 113,992,161 (GRCm39) missense probably damaging 1.00
R8166:Aqr UTSW 2 113,943,806 (GRCm39) missense possibly damaging 0.95
R8712:Aqr UTSW 2 113,949,358 (GRCm39) missense probably damaging 1.00
R8904:Aqr UTSW 2 113,967,474 (GRCm39) missense probably damaging 0.98
R9487:Aqr UTSW 2 113,934,528 (GRCm39) missense probably benign 0.04
R9527:Aqr UTSW 2 113,932,037 (GRCm39) missense probably benign 0.02
R9664:Aqr UTSW 2 113,971,396 (GRCm39) nonsense probably null
Z1176:Aqr UTSW 2 113,940,472 (GRCm39) missense probably benign 0.25
Z1176:Aqr UTSW 2 113,938,603 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AGTTAATATTCACTGCAACCCCTC -3'
(R):5'- AGTTCAGTCACGGGGTATTG -3'

Sequencing Primer
(F):5'- TCTCCCCAGCACGTATGTGG -3'
(R):5'- TGAGTGGAGTTCATTGACTTGCC -3'
Posted On 2016-10-05