Incidental Mutation 'R5489:Aqr'
ID431965
Institutional Source Beutler Lab
Gene Symbol Aqr
Ensembl Gene ENSMUSG00000040383
Gene Nameaquarius
Synonyms
MMRRC Submission 043050-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5489 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location114101170-114187024 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 114133073 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 632 (N632S)
Ref Sequence ENSEMBL: ENSMUSP00000047157 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043160] [ENSMUST00000102543]
Predicted Effect probably damaging
Transcript: ENSMUST00000043160
AA Change: N632S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000047157
Gene: ENSMUSG00000040383
AA Change: N632S

DomainStartEndE-ValueType
Pfam:Aquarius_N 18 802 N/A PFAM
Pfam:ResIII 797 911 8.2e-7 PFAM
Pfam:AAA_11 801 1111 9.6e-32 PFAM
Pfam:AAA_19 807 894 3.7e-11 PFAM
Pfam:AAA_12 1119 1312 2.1e-27 PFAM
low complexity region 1394 1417 N/A INTRINSIC
low complexity region 1455 1468 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000102543
AA Change: N632S

PolyPhen 2 Score 0.660 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000099602
Gene: ENSMUSG00000040383
AA Change: N632S

DomainStartEndE-ValueType
low complexity region 43 56 N/A INTRINSIC
low complexity region 112 124 N/A INTRINSIC
low complexity region 762 776 N/A INTRINSIC
Pfam:AAA_11 801 1111 3.2e-32 PFAM
Pfam:AAA_19 807 893 6.5e-11 PFAM
Pfam:AAA_12 1119 1312 2.6e-27 PFAM
low complexity region 1348 1359 N/A INTRINSIC
low complexity region 1371 1382 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125460
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126701
Meta Mutation Damage Score 0.0837 question?
Coding Region Coverage
  • 1x: 98.4%
  • 3x: 97.4%
  • 10x: 95.4%
  • 20x: 91.6%
Validation Efficiency 95% (57/60)
MGI Phenotype PHENOTYPE: Homozygotes for a targeted null mutation exhibit severe defects in placental vascularization with few vessels entering the placenta and little branching. Mutants die between embryonic days 9.5 and 10.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730455P16Rik A T 11: 80,377,952 M1K probably null Het
Abca14 T A 7: 120,252,250 V817D probably damaging Het
Bms1 T C 6: 118,413,745 T208A possibly damaging Het
Brd8 A T 18: 34,608,645 probably null Het
Caln1 G T 5: 130,414,832 R2L possibly damaging Het
Cdk17 A G 10: 93,232,412 T344A probably damaging Het
Chd8 A T 14: 52,213,048 probably benign Het
Clec14a A G 12: 58,268,249 F196L probably damaging Het
Clec2f T C 6: 129,020,486 noncoding transcript Het
Col4a1 A T 8: 11,312,550 probably benign Het
Col9a3 G A 2: 180,616,525 R579H probably damaging Het
Cyb561 A G 11: 105,935,523 V202A probably benign Het
Cyp2c69 T G 19: 39,851,159 Q340P probably null Het
D630003M21Rik T A 2: 158,217,021 T320S probably benign Het
D630045J12Rik A T 6: 38,196,847 S129T possibly damaging Het
Ddx54 A G 5: 120,624,721 T636A probably benign Het
Dnah8 T G 17: 30,790,956 F3774V probably damaging Het
Ern1 A G 11: 106,407,529 S674P probably damaging Het
Fam13a A T 6: 59,024,318 L8Q probably null Het
Fam83b T C 9: 76,545,599 N62S probably benign Het
Foxred1 A T 9: 35,209,970 V94E probably damaging Het
Frmd8 T A 19: 5,852,652 Q457L probably damaging Het
Gm1966 T A 7: 106,601,590 noncoding transcript Het
Heatr6 A G 11: 83,774,432 E741G probably damaging Het
Hnrnpab A G 11: 51,604,813 L133S probably damaging Het
Itga2 A T 13: 114,843,435 W1077R probably damaging Het
Kat6b A G 14: 21,669,264 D1228G probably damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Kmt2a A T 9: 44,841,038 probably benign Het
Leap2 T G 11: 53,422,413 *77C probably null Het
Mmp20 A G 9: 7,643,957 probably null Het
Mrps9 T G 1: 42,898,433 probably benign Het
Muc2 T C 7: 141,751,432 S158P probably benign Het
Mus81 T C 19: 5,487,889 probably benign Het
Nrip3 T C 7: 109,761,838 T210A probably damaging Het
Olfr591 T C 7: 103,173,451 Y62C probably damaging Het
Padi2 T C 4: 140,944,488 F509S probably damaging Het
Pcdha12 A G 18: 37,022,207 T660A probably benign Het
Pdzd2 G A 15: 12,382,676 P1197L probably benign Het
Rec8 A T 14: 55,622,826 Q291L probably benign Het
Robo4 CGG CG 9: 37,411,490 probably null Het
Sart3 A G 5: 113,771,380 W86R probably damaging Het
Slc17a4 A G 13: 23,898,842 probably null Het
Tdpoz1 T A 3: 93,670,667 Y270F possibly damaging Het
Thap3 T A 4: 151,985,652 probably benign Het
Tmem45a T A 16: 56,825,711 probably null Het
Trim43a A T 9: 88,582,176 I47F probably damaging Het
Vps13b A T 15: 35,770,542 I2044L probably benign Het
Zfp735 G A 11: 73,710,593 W121* probably null Het
Zmym2 A G 14: 56,956,255 K1176E possibly damaging Het
Other mutations in Aqr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00572:Aqr APN 2 114125942 missense possibly damaging 0.90
IGL00694:Aqr APN 2 114151525 missense probably damaging 1.00
IGL02113:Aqr APN 2 114120027 nonsense probably null
IGL02297:Aqr APN 2 114150481 missense probably benign 0.24
IGL02380:Aqr APN 2 114109936 missense probably damaging 1.00
IGL02410:Aqr APN 2 114136917 missense possibly damaging 0.85
IGL02413:Aqr APN 2 114118780 missense possibly damaging 0.87
IGL02474:Aqr APN 2 114112646 missense probably damaging 1.00
IGL02941:Aqr APN 2 114113354 missense probably damaging 1.00
IGL02981:Aqr APN 2 114134824 splice site probably benign
IGL03001:Aqr APN 2 114146919 missense probably benign
IGL03092:Aqr APN 2 114158943 missense probably benign 0.38
IGL03222:Aqr APN 2 114121256 missense probably damaging 1.00
capricorn UTSW 2 114105882 missense probably damaging 1.00
Goat UTSW 2 114157575 missense probably damaging 1.00
Pliades UTSW 2 114132976 missense probably damaging 1.00
sagittarius UTSW 2 114149016 missense probably damaging 1.00
Zodiac UTSW 2 114108109 missense probably damaging 0.96
PIT4531001:Aqr UTSW 2 114130734 missense possibly damaging 0.94
R0103:Aqr UTSW 2 114149016 missense probably damaging 1.00
R0103:Aqr UTSW 2 114149016 missense probably damaging 1.00
R0152:Aqr UTSW 2 114159010 missense probably benign 0.07
R0352:Aqr UTSW 2 114170052 missense probably damaging 1.00
R0371:Aqr UTSW 2 114157604 missense possibly damaging 0.80
R0374:Aqr UTSW 2 114130611 missense probably damaging 1.00
R0550:Aqr UTSW 2 114132976 missense probably damaging 1.00
R0604:Aqr UTSW 2 114130604 missense probably benign 0.00
R0685:Aqr UTSW 2 114140977 missense probably damaging 1.00
R1236:Aqr UTSW 2 114116655 missense probably damaging 1.00
R1434:Aqr UTSW 2 114150409 missense probably damaging 1.00
R1806:Aqr UTSW 2 114161652 missense probably damaging 1.00
R2154:Aqr UTSW 2 114137004 missense probably damaging 1.00
R2185:Aqr UTSW 2 114130534 critical splice donor site probably null
R2377:Aqr UTSW 2 114140940 missense possibly damaging 0.58
R2862:Aqr UTSW 2 114136917 missense probably damaging 1.00
R3615:Aqr UTSW 2 114136887 missense probably damaging 1.00
R3616:Aqr UTSW 2 114136887 missense probably damaging 1.00
R3713:Aqr UTSW 2 114118669 splice site probably benign
R3715:Aqr UTSW 2 114118669 splice site probably benign
R4586:Aqr UTSW 2 114112577 missense probably benign 0.06
R4663:Aqr UTSW 2 114161666 nonsense probably null
R4809:Aqr UTSW 2 114175214 utr 5 prime probably benign
R4887:Aqr UTSW 2 114150509 missense probably damaging 1.00
R4888:Aqr UTSW 2 114150509 missense probably damaging 1.00
R4952:Aqr UTSW 2 114109937 missense probably damaging 1.00
R4974:Aqr UTSW 2 114113351 missense probably damaging 1.00
R5050:Aqr UTSW 2 114112609 nonsense probably null
R5050:Aqr UTSW 2 114170025 critical splice donor site probably null
R5213:Aqr UTSW 2 114113327 missense probably damaging 1.00
R5263:Aqr UTSW 2 114116578 missense probably damaging 1.00
R5470:Aqr UTSW 2 114157575 missense probably damaging 1.00
R5488:Aqr UTSW 2 114133073 missense probably damaging 1.00
R5567:Aqr UTSW 2 114148970 missense probably damaging 1.00
R5570:Aqr UTSW 2 114148970 missense probably damaging 1.00
R5641:Aqr UTSW 2 114149034 missense probably damaging 1.00
R5685:Aqr UTSW 2 114156265 missense possibly damaging 0.87
R5963:Aqr UTSW 2 114126961 missense probably damaging 1.00
R5992:Aqr UTSW 2 114143049 nonsense probably null
R6015:Aqr UTSW 2 114175165 start codon destroyed probably null 0.53
R6253:Aqr UTSW 2 114156277 missense possibly damaging 0.93
R6264:Aqr UTSW 2 114109964 missense probably damaging 1.00
R6773:Aqr UTSW 2 114148996 missense possibly damaging 0.64
R6877:Aqr UTSW 2 114116571 nonsense probably null
R7211:Aqr UTSW 2 114134723 missense probably benign 0.01
R7232:Aqr UTSW 2 114105882 missense probably damaging 1.00
R7308:Aqr UTSW 2 114104062 missense possibly damaging 0.86
R7396:Aqr UTSW 2 114119946 nonsense probably null
R7490:Aqr UTSW 2 114158868 critical splice donor site probably null
R7526:Aqr UTSW 2 114108109 missense probably damaging 0.96
R7629:Aqr UTSW 2 114114593 missense probably damaging 1.00
R7828:Aqr UTSW 2 114149016 missense probably damaging 1.00
R8037:Aqr UTSW 2 114161680 missense probably damaging 1.00
R8166:Aqr UTSW 2 114113325 missense possibly damaging 0.95
R8712:Aqr UTSW 2 114118877 missense probably damaging 1.00
R8904:Aqr UTSW 2 114136993 missense not run
Z1176:Aqr UTSW 2 114108122 missense probably damaging 0.98
Z1176:Aqr UTSW 2 114109991 missense probably benign 0.25
Predicted Primers PCR Primer
(F):5'- AGTTAATATTCACTGCAACCCCTC -3'
(R):5'- AGTTCAGTCACGGGGTATTG -3'

Sequencing Primer
(F):5'- TCTCCCCAGCACGTATGTGG -3'
(R):5'- TGAGTGGAGTTCATTGACTTGCC -3'
Posted On2016-10-05