Incidental Mutation 'R5489:Fam83b'
ID431990
Institutional Source Beutler Lab
Gene Symbol Fam83b
Ensembl Gene ENSMUSG00000032358
Gene Namefamily with sequence similarity 83, member B
SynonymsC530008M07Rik
MMRRC Submission 043050-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.095) question?
Stock #R5489 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location76490054-76567116 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 76545599 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 62 (N62S)
Ref Sequence ENSEMBL: ENSMUSP00000139354 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098546] [ENSMUST00000183437]
Predicted Effect probably benign
Transcript: ENSMUST00000098546
AA Change: N62S

PolyPhen 2 Score 0.045 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000096146
Gene: ENSMUSG00000032358
AA Change: N62S

DomainStartEndE-ValueType
Pfam:DUF1669 12 282 5.6e-109 PFAM
Pfam:PLDc_2 139 277 2.4e-12 PFAM
low complexity region 557 574 N/A INTRINSIC
low complexity region 731 742 N/A INTRINSIC
low complexity region 747 760 N/A INTRINSIC
low complexity region 826 846 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000183437
AA Change: N62S

PolyPhen 2 Score 0.045 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000139354
Gene: ENSMUSG00000032358
AA Change: N62S

DomainStartEndE-ValueType
Pfam:DUF1669 7 283 2.8e-111 PFAM
Pfam:PLDc_2 139 277 2.4e-9 PFAM
low complexity region 557 574 N/A INTRINSIC
low complexity region 731 742 N/A INTRINSIC
low complexity region 747 760 N/A INTRINSIC
low complexity region 826 846 N/A INTRINSIC
Meta Mutation Damage Score 0.054 question?
Coding Region Coverage
  • 1x: 98.4%
  • 3x: 97.4%
  • 10x: 95.4%
  • 20x: 91.6%
Validation Efficiency 95% (57/60)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730455P16Rik A T 11: 80,377,952 M1K probably null Het
Abca14 T A 7: 120,252,250 V817D probably damaging Het
Aqr T C 2: 114,133,073 N632S probably damaging Het
Bms1 T C 6: 118,413,745 T208A possibly damaging Het
Brd8 A T 18: 34,608,645 probably null Het
Caln1 G T 5: 130,414,832 R2L possibly damaging Het
Cdk17 A G 10: 93,232,412 T344A probably damaging Het
Chd8 A T 14: 52,213,048 probably benign Het
Clec14a A G 12: 58,268,249 F196L probably damaging Het
Clec2f T C 6: 129,020,486 noncoding transcript Het
Col4a1 A T 8: 11,312,550 probably benign Het
Col9a3 G A 2: 180,616,525 R579H probably damaging Het
Cyb561 A G 11: 105,935,523 V202A probably benign Het
Cyp2c69 T G 19: 39,851,159 Q340P probably null Het
D630003M21Rik T A 2: 158,217,021 T320S probably benign Het
D630045J12Rik A T 6: 38,196,847 S129T possibly damaging Het
Ddx54 A G 5: 120,624,721 T636A probably benign Het
Dnah8 T G 17: 30,790,956 F3774V probably damaging Het
Ern1 A G 11: 106,407,529 S674P probably damaging Het
Fam13a A T 6: 59,024,318 L8Q probably null Het
Foxred1 A T 9: 35,209,970 V94E probably damaging Het
Frmd8 T A 19: 5,852,652 Q457L probably damaging Het
Gm1966 T A 7: 106,601,590 noncoding transcript Het
Heatr6 A G 11: 83,774,432 E741G probably damaging Het
Hnrnpab A G 11: 51,604,813 L133S probably damaging Het
Itga2 A T 13: 114,843,435 W1077R probably damaging Het
Kat6b A G 14: 21,669,264 D1228G probably damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Kmt2a A T 9: 44,841,038 probably benign Het
Leap2 T G 11: 53,422,413 *77C probably null Het
Mmp20 A G 9: 7,643,957 probably null Het
Mrps9 T G 1: 42,898,433 probably benign Het
Muc2 T C 7: 141,751,432 S158P probably benign Het
Mus81 T C 19: 5,487,889 probably benign Het
Nrip3 T C 7: 109,761,838 T210A probably damaging Het
Olfr591 T C 7: 103,173,451 Y62C probably damaging Het
Padi2 T C 4: 140,944,488 F509S probably damaging Het
Pcdha12 A G 18: 37,022,207 T660A probably benign Het
Pdzd2 G A 15: 12,382,676 P1197L probably benign Het
Rec8 A T 14: 55,622,826 Q291L probably benign Het
Robo4 CGG CG 9: 37,411,490 probably null Het
Sart3 A G 5: 113,771,380 W86R probably damaging Het
Slc17a4 A G 13: 23,898,842 probably null Het
Tdpoz1 T A 3: 93,670,667 Y270F possibly damaging Het
Thap3 T A 4: 151,985,652 probably benign Het
Tmem45a T A 16: 56,825,711 probably null Het
Trim43a A T 9: 88,582,176 I47F probably damaging Het
Vps13b A T 15: 35,770,542 I2044L probably benign Het
Zfp735 G A 11: 73,710,593 W121* probably null Het
Zmym2 A G 14: 56,956,255 K1176E possibly damaging Het
Other mutations in Fam83b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00236:Fam83b APN 9 76490978 missense probably benign 0.00
IGL01554:Fam83b APN 9 76502121 missense probably benign 0.33
IGL01694:Fam83b APN 9 76490990 missense probably benign 0.13
IGL02009:Fam83b APN 9 76492322 missense probably damaging 1.00
IGL02531:Fam83b APN 9 76492000 missense possibly damaging 0.61
IGL03328:Fam83b APN 9 76493042 missense probably benign 0.01
PIT4581001:Fam83b UTSW 9 76491152 missense probably damaging 1.00
R0110:Fam83b UTSW 9 76492826 missense possibly damaging 0.75
R0469:Fam83b UTSW 9 76492826 missense possibly damaging 0.75
R0510:Fam83b UTSW 9 76492826 missense possibly damaging 0.75
R0732:Fam83b UTSW 9 76492928 nonsense probably null
R0946:Fam83b UTSW 9 76491397 missense probably damaging 0.96
R0961:Fam83b UTSW 9 76491295 missense probably damaging 0.97
R1101:Fam83b UTSW 9 76545670 missense possibly damaging 0.68
R1200:Fam83b UTSW 9 76492312 missense probably damaging 1.00
R1248:Fam83b UTSW 9 76503076 missense probably benign 0.35
R1420:Fam83b UTSW 9 76492612 missense possibly damaging 0.94
R1429:Fam83b UTSW 9 76492577 missense probably benign
R1939:Fam83b UTSW 9 76493080 missense probably damaging 1.00
R1992:Fam83b UTSW 9 76492022 missense probably benign
R2102:Fam83b UTSW 9 76492705 missense probably damaging 0.96
R2134:Fam83b UTSW 9 76491016 missense probably damaging 1.00
R2398:Fam83b UTSW 9 76502218 missense probably damaging 1.00
R2878:Fam83b UTSW 9 76490810 missense probably damaging 1.00
R4092:Fam83b UTSW 9 76491661 missense probably benign 0.24
R4204:Fam83b UTSW 9 76503053 missense probably benign 0.09
R4537:Fam83b UTSW 9 76492142 missense probably benign 0.10
R4920:Fam83b UTSW 9 76491868 missense probably benign
R5456:Fam83b UTSW 9 76492595 missense probably benign
R5473:Fam83b UTSW 9 76491500 missense probably damaging 1.00
R5488:Fam83b UTSW 9 76545599 missense probably benign 0.05
R5876:Fam83b UTSW 9 76491850 missense possibly damaging 0.92
R6150:Fam83b UTSW 9 76492357 missense probably damaging 1.00
R6374:Fam83b UTSW 9 76492907 missense probably benign 0.31
R6468:Fam83b UTSW 9 76502131 nonsense probably null
R6912:Fam83b UTSW 9 76490932 missense probably damaging 0.99
R7022:Fam83b UTSW 9 76502112 frame shift probably null
R7073:Fam83b UTSW 9 76545749 missense probably benign 0.18
R7356:Fam83b UTSW 9 76492853 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- AGGAGGTCTATGTGGGTACTCC -3'
(R):5'- TGAACATTTGAAAGTTCCCCTCATC -3'

Sequencing Primer
(F):5'- CCTAAGAGTCCGGGCATCAC -3'
(R):5'- CATGGAGGCTTCATCAATGC -3'
Posted On2016-10-05