Incidental Mutation 'R5489:Mus81'
ID432015
Institutional Source Beutler Lab
Gene Symbol Mus81
Ensembl Gene ENSMUSG00000024906
Gene NameMUS81 structure-specific endonuclease subunit
Synonyms
MMRRC Submission 043050-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.385) question?
Stock #R5489 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location5482345-5488402 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to C at 5487889 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000147514 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025841] [ENSMUST00000116560] [ENSMUST00000124334] [ENSMUST00000126471] [ENSMUST00000209469]
Predicted Effect silent
Transcript: ENSMUST00000025841
SMART Domains Protein: ENSMUSP00000025841
Gene: ENSMUSG00000024906

DomainStartEndE-ValueType
SCOP:d1jmsa1 9 73 7e-3 SMART
PDB:2KP7|A 11 90 5e-51 PDB
low complexity region 92 107 N/A INTRINSIC
PDB:2MC3|A 121 229 1e-48 PDB
ERCC4 270 372 8.31e-26 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000116560
SMART Domains Protein: ENSMUSP00000112259
Gene: ENSMUSG00000056201

DomainStartEndE-ValueType
ADF 19 154 5.3e-56 SMART
low complexity region 195 205 N/A INTRINSIC
Predicted Effect silent
Transcript: ENSMUST00000124334
SMART Domains Protein: ENSMUSP00000114895
Gene: ENSMUSG00000024906

DomainStartEndE-ValueType
SCOP:d1jmsa1 9 73 9e-3 SMART
PDB:2KP7|A 11 90 9e-51 PDB
low complexity region 92 107 N/A INTRINSIC
PDB:2MC3|A 121 229 3e-48 PDB
ERCC4 270 372 8.31e-26 SMART
Predicted Effect unknown
Transcript: ENSMUST00000126471
AA Change: I55V
SMART Domains Protein: ENSMUSP00000121435
Gene: ENSMUSG00000024906
AA Change: I55V

DomainStartEndE-ValueType
PDB:2KP7|A 11 72 8e-21 PDB
Predicted Effect silent
Transcript: ENSMUST00000133436
SMART Domains Protein: ENSMUSP00000118580
Gene: ENSMUSG00000024906

DomainStartEndE-ValueType
PDB:2KP7|A 2 55 5e-30 PDB
low complexity region 57 72 N/A INTRINSIC
PDB:2MC3|A 86 194 8e-50 PDB
ERCC4 235 337 8.31e-26 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140365
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144422
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146661
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147961
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149908
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151932
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154215
Predicted Effect probably benign
Transcript: ENSMUST00000209469
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 98.4%
  • 3x: 97.4%
  • 10x: 95.4%
  • 20x: 91.6%
Validation Efficiency 95% (57/60)
MGI Phenotype PHENOTYPE: Homozygous and heterozygous null mice for one allele display increased tumor incidence and reduced life spans. Homozygous null mice for a second allele display normal life span and tumor incidence. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730455P16Rik A T 11: 80,377,952 M1K probably null Het
Abca14 T A 7: 120,252,250 V817D probably damaging Het
Aqr T C 2: 114,133,073 N632S probably damaging Het
Bms1 T C 6: 118,413,745 T208A possibly damaging Het
Brd8 A T 18: 34,608,645 probably null Het
Caln1 G T 5: 130,414,832 R2L possibly damaging Het
Cdk17 A G 10: 93,232,412 T344A probably damaging Het
Chd8 A T 14: 52,213,048 probably benign Het
Clec14a A G 12: 58,268,249 F196L probably damaging Het
Clec2f T C 6: 129,020,486 noncoding transcript Het
Col4a1 A T 8: 11,312,550 probably benign Het
Col9a3 G A 2: 180,616,525 R579H probably damaging Het
Cyb561 A G 11: 105,935,523 V202A probably benign Het
Cyp2c69 T G 19: 39,851,159 Q340P probably null Het
D630003M21Rik T A 2: 158,217,021 T320S probably benign Het
D630045J12Rik A T 6: 38,196,847 S129T possibly damaging Het
Ddx54 A G 5: 120,624,721 T636A probably benign Het
Dnah8 T G 17: 30,790,956 F3774V probably damaging Het
Ern1 A G 11: 106,407,529 S674P probably damaging Het
Fam13a A T 6: 59,024,318 L8Q probably null Het
Fam83b T C 9: 76,545,599 N62S probably benign Het
Foxred1 A T 9: 35,209,970 V94E probably damaging Het
Frmd8 T A 19: 5,852,652 Q457L probably damaging Het
Gm1966 T A 7: 106,601,590 noncoding transcript Het
Heatr6 A G 11: 83,774,432 E741G probably damaging Het
Hnrnpab A G 11: 51,604,813 L133S probably damaging Het
Itga2 A T 13: 114,843,435 W1077R probably damaging Het
Kat6b A G 14: 21,669,264 D1228G probably damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Kmt2a A T 9: 44,841,038 probably benign Het
Leap2 T G 11: 53,422,413 *77C probably null Het
Mmp20 A G 9: 7,643,957 probably null Het
Mrps9 T G 1: 42,898,433 probably benign Het
Muc2 T C 7: 141,751,432 S158P probably benign Het
Nrip3 T C 7: 109,761,838 T210A probably damaging Het
Olfr591 T C 7: 103,173,451 Y62C probably damaging Het
Padi2 T C 4: 140,944,488 F509S probably damaging Het
Pcdha12 A G 18: 37,022,207 T660A probably benign Het
Pdzd2 G A 15: 12,382,676 P1197L probably benign Het
Rec8 A T 14: 55,622,826 Q291L probably benign Het
Robo4 CGG CG 9: 37,411,490 probably null Het
Sart3 A G 5: 113,771,380 W86R probably damaging Het
Slc17a4 A G 13: 23,898,842 probably null Het
Tdpoz1 T A 3: 93,670,667 Y270F possibly damaging Het
Thap3 T A 4: 151,985,652 probably benign Het
Tmem45a T A 16: 56,825,711 probably null Het
Trim43a A T 9: 88,582,176 I47F probably damaging Het
Vps13b A T 15: 35,770,542 I2044L probably benign Het
Zfp735 G A 11: 73,710,593 W121* probably null Het
Zmym2 A G 14: 56,956,255 K1176E possibly damaging Het
Other mutations in Mus81
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02120:Mus81 APN 19 5485633 unclassified probably benign
IGL03140:Mus81 APN 19 5483956 missense probably damaging 1.00
IGL03370:Mus81 APN 19 5484963 unclassified probably benign
city UTSW 19 5487793 missense probably benign 0.30
country UTSW 19 5484211 missense probably damaging 1.00
R0116:Mus81 UTSW 19 5486524 missense probably damaging 1.00
R0480:Mus81 UTSW 19 5487931 unclassified probably benign
R1243:Mus81 UTSW 19 5485117 missense probably benign
R1439:Mus81 UTSW 19 5485117 missense probably benign
R1477:Mus81 UTSW 19 5486334 missense probably benign 0.00
R1795:Mus81 UTSW 19 5483476 missense probably benign 0.00
R2346:Mus81 UTSW 19 5484963 unclassified probably benign
R2863:Mus81 UTSW 19 5486500 missense probably damaging 1.00
R3785:Mus81 UTSW 19 5485361 unclassified probably benign
R5312:Mus81 UTSW 19 5483494 missense possibly damaging 0.79
R6037:Mus81 UTSW 19 5484004 missense probably damaging 1.00
R6037:Mus81 UTSW 19 5484004 missense probably damaging 1.00
R6970:Mus81 UTSW 19 5485526 missense probably benign 0.45
R7037:Mus81 UTSW 19 5486080 missense probably damaging 1.00
R7060:Mus81 UTSW 19 5487793 missense probably benign 0.30
R7100:Mus81 UTSW 19 5484211 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTAGACACAGCCTGCACCTAAG -3'
(R):5'- AGCCAGTCTAGTTCTTATGGCG -3'

Sequencing Primer
(F):5'- CAGCCTGCACCTAAGAAATTTAG -3'
(R):5'- AACCCGCTCTTCGTTCGTTG -3'
Posted On2016-10-05