Incidental Mutation 'R5490:Rassf5'
ID432020
Institutional Source Beutler Lab
Gene Symbol Rassf5
Ensembl Gene ENSMUSG00000026430
Gene NameRas association (RalGDS/AF-6) domain family member 5
SynonymsNore1A, Nore1B, Rapl, 1300019G20Rik
MMRRC Submission 043051-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.163) question?
Stock #R5490 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location131176410-131245258 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 131181195 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 163 (Q163L)
Ref Sequence ENSEMBL: ENSMUSP00000067011 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027688] [ENSMUST00000068564] [ENSMUST00000068791] [ENSMUST00000112442] [ENSMUST00000131855] [ENSMUST00000151874] [ENSMUST00000212202]
Predicted Effect probably benign
Transcript: ENSMUST00000027688
AA Change: Q311L

PolyPhen 2 Score 0.326 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000027688
Gene: ENSMUSG00000026430
AA Change: Q311L

DomainStartEndE-ValueType
low complexity region 31 39 N/A INTRINSIC
low complexity region 49 67 N/A INTRINSIC
low complexity region 76 90 N/A INTRINSIC
C1 116 165 6.29e-8 SMART
RA 267 359 1.07e-22 SMART
Pfam:Nore1-SARAH 366 405 1.1e-19 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000068564
AA Change: Q163L

PolyPhen 2 Score 0.951 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000067011
Gene: ENSMUSG00000026430
AA Change: Q163L

DomainStartEndE-ValueType
RA 119 211 1.07e-22 SMART
PDB:4LGD|H 212 260 5e-25 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000068791
SMART Domains Protein: ENSMUSP00000067461
Gene: ENSMUSG00000026427

DomainStartEndE-ValueType
PUA 99 173 1.07e-5 SMART
low complexity region 297 306 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112442
SMART Domains Protein: ENSMUSP00000108061
Gene: ENSMUSG00000026430

DomainStartEndE-ValueType
low complexity region 31 39 N/A INTRINSIC
low complexity region 49 67 N/A INTRINSIC
low complexity region 76 90 N/A INTRINSIC
C1 116 165 6.29e-8 SMART
PDB:3DDC|B 198 301 7e-62 PDB
Blast:RA 267 294 5e-9 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000131855
SMART Domains Protein: ENSMUSP00000137678
Gene: ENSMUSG00000026427

DomainStartEndE-ValueType
PUA 99 173 1.07e-5 SMART
low complexity region 297 306 N/A INTRINSIC
Pfam:SUI1 472 554 8.7e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000151874
SMART Domains Protein: ENSMUSP00000138061
Gene: ENSMUSG00000026427

DomainStartEndE-ValueType
PUA 99 173 1.07e-5 SMART
low complexity region 297 306 N/A INTRINSIC
Pfam:SUI1 472 556 1e-13 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000212202
AA Change: Q211L

PolyPhen 2 Score 0.870 (Sensitivity: 0.83; Specificity: 0.93)
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.3%
  • 10x: 95.2%
  • 20x: 90.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the Ras association domain family. It functions as a tumor suppressor, and is inactivated in a variety of cancers. The encoded protein localizes to centrosomes and microtubules, and associates with the GTP-activated forms of Ras, Rap1, and several other Ras-like small GTPases. The protein regulates lymphocyte adhesion and suppresses cell growth in response to activated Rap1 or Ras. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a null allele have defects in lymphocyte homing to lymphoid tissues, B cell maturation and dendritic cell function, and display lymphocyte hyperproliferation leading to lupus glomerulonephritis and lymphomas. Homozygotes for another null allele are resistant to TNF-induced apoptosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810013L24Rik T A 16: 8,855,857 V216E probably damaging Het
2310035C23Rik T A 1: 105,719,501 V672D probably damaging Het
4933406M09Rik A G 1: 134,389,928 D146G probably damaging Het
Aatf C T 11: 84,510,273 G174D probably damaging Het
Abcc1 G T 16: 14,410,917 G343C probably damaging Het
Asic2 T C 11: 80,889,820 N370S probably benign Het
Btnl9 T C 11: 49,169,568 E451G probably damaging Het
Cblb A G 16: 52,174,370 H658R possibly damaging Het
Cdca2 T C 14: 67,680,284 E555G possibly damaging Het
Chfr A G 5: 110,153,129 S299G possibly damaging Het
Eea1 A G 10: 96,026,054 E741G probably benign Het
Gapvd1 T C 2: 34,693,433 D1057G probably benign Het
Glyat C T 19: 12,650,281 T80M probably benign Het
Gpr87 T C 3: 59,179,326 S253G probably damaging Het
Hmgxb3 A G 18: 61,162,977 S320P probably damaging Het
Kcnq5 C T 1: 21,479,468 G345D probably damaging Het
Kif5c T C 2: 49,758,858 V938A probably benign Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Madd G T 2: 91,170,635 T467K possibly damaging Het
Mamdc4 T C 2: 25,565,878 D706G probably damaging Het
Map2 A G 1: 66,413,133 H476R probably damaging Het
Mpeg1 T C 19: 12,461,693 S172P probably damaging Het
Nkx2-3 A T 19: 43,612,654 T52S probably benign Het
Nup210 C T 6: 91,085,988 V230I probably damaging Het
Olfr1009 G T 2: 85,722,322 A306S probably benign Het
Olfr348 T A 2: 36,787,181 Y219N probably damaging Het
Olfr568 T C 7: 102,877,893 S258P probably damaging Het
Pepd A G 7: 34,942,690 probably null Het
Ppp1r36 T A 12: 76,437,986 W238R probably damaging Het
Ppp1r36 G T 12: 76,437,987 W238L possibly damaging Het
Prpf6 T G 2: 181,608,165 D39E probably benign Het
Rbm43 T A 2: 51,925,595 T205S probably benign Het
Robo4 CGG CG 9: 37,411,490 probably null Het
Sds C A 5: 120,483,650 Q286K possibly damaging Het
Slc35a3 A T 3: 116,681,190 C184* probably null Het
Smg1 G A 7: 118,139,436 T3530I possibly damaging Het
Sspo T C 6: 48,493,280 V591A probably benign Het
Stam2 T C 2: 52,720,917 D31G probably damaging Het
Star A G 8: 25,809,917 K96E probably damaging Het
Syne3 A G 12: 104,955,672 L495P probably damaging Het
Tceanc2 A T 4: 107,165,649 M47K probably benign Het
Tecpr2 T C 12: 110,914,684 L85P probably damaging Het
Tmem241 C T 18: 12,043,263 R116K probably benign Het
Yipf2 G A 9: 21,592,191 A20V probably benign Het
Zc3h4 T A 7: 16,429,005 D443E unknown Het
Zfp184 T A 13: 21,958,577 V151D probably benign Het
Zhx1 T C 15: 58,053,299 Y517C probably damaging Het
Other mutations in Rassf5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02728:Rassf5 APN 1 131180599 missense probably damaging 0.96
IGL03055:Rassf5 UTSW 1 131244995 missense probably benign 0.00
R0464:Rassf5 UTSW 1 131212261 missense probably benign 0.00
R0589:Rassf5 UTSW 1 131244983 missense probably damaging 0.99
R0634:Rassf5 UTSW 1 131244956 missense probably damaging 0.99
R0639:Rassf5 UTSW 1 131245066 missense probably damaging 1.00
R0727:Rassf5 UTSW 1 131181265 missense probably damaging 1.00
R1926:Rassf5 UTSW 1 131212339 missense probably damaging 1.00
R2310:Rassf5 UTSW 1 131244740 missense probably damaging 1.00
R5354:Rassf5 UTSW 1 131180648 missense probably benign 0.00
R5422:Rassf5 UTSW 1 131181174 missense possibly damaging 0.87
R6189:Rassf5 UTSW 1 131244979 missense probably damaging 1.00
R6328:Rassf5 UTSW 1 131180668 missense probably damaging 1.00
R6531:Rassf5 UTSW 1 131244814 missense possibly damaging 0.93
R6759:Rassf5 UTSW 1 131182251 missense probably benign 0.08
R7115:Rassf5 UTSW 1 131181249 missense probably benign 0.21
R7350:Rassf5 UTSW 1 131178536 missense possibly damaging 0.75
R7910:Rassf5 UTSW 1 131180629 missense probably benign 0.15
R8286:Rassf5 UTSW 1 131212330 missense possibly damaging 0.73
R8706:Rassf5 UTSW 1 131245045 missense probably benign 0.00
R8732:Rassf5 UTSW 1 131178527 makesense probably null
Z1176:Rassf5 UTSW 1 131182217 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAGAGATTAGGAGCCCAGAGCC -3'
(R):5'- CCCAGTCCATCTATGATGCC -3'

Sequencing Primer
(F):5'- AGCCCAGGGTGTGTCTTTCC -3'
(R):5'- CCAGTCCATCTATGATGCCATTAAGG -3'
Posted On2016-10-05