Incidental Mutation 'R5490:Kif5c'
ID432025
Institutional Source Beutler Lab
Gene Symbol Kif5c
Ensembl Gene ENSMUSG00000026764
Gene Namekinesin family member 5C
SynonymsKhc
MMRRC Submission 043051-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5490 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location49619298-49774778 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 49758858 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 938 (V938A)
Ref Sequence ENSEMBL: ENSMUSP00000028102 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028102]
PDB Structure
Crystal Structure of the Kif1A Motor Domain Complexed With Mg-AMPPNP [X-RAY DIFFRACTION]
Crystal Structure of the Kif1A Motor Domain Complexed With Mg-AMPPNP [X-RAY DIFFRACTION]
Crystal Structure of the Kif1A Motor Domain Complexed With ADP-Mg-AlFx [X-RAY DIFFRACTION]
Crystal Structure of the Kif1A Motor Domain Complexed With ADP-Mg-VO4 [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000028102
AA Change: V938A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000028102
Gene: ENSMUSG00000026764
AA Change: V938A

DomainStartEndE-ValueType
KISc 6 335 2.8e-173 SMART
low complexity region 340 357 N/A INTRINSIC
coiled coil region 407 541 N/A INTRINSIC
coiled coil region 592 803 N/A INTRINSIC
coiled coil region 826 915 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127245
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132968
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.3%
  • 10x: 95.2%
  • 20x: 90.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a kinesin heavy chain subunit involved in the transport of cargo within the central nervous system. The encoded protein, which acts as a tetramer by associating with another heavy chain and two light chains, interacts with protein kinase CK2. Mutations in this gene have been associated with complex cortical dysplasia with other brain malformations-2. Two transcript variants, one protein-coding and the other non-protein coding, have been found for this gene. [provided by RefSeq, Jul 2015]
PHENOTYPE: Mice homezygous for disruptions in this gene are viable, fertile, and of normal size. The brain is normal but slightly reduced in size with decreased numbers of motor neurons an somewhat more sensory nerves than normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810013L24Rik T A 16: 8,855,857 V216E probably damaging Het
2310035C23Rik T A 1: 105,719,501 V672D probably damaging Het
4933406M09Rik A G 1: 134,389,928 D146G probably damaging Het
Aatf C T 11: 84,510,273 G174D probably damaging Het
Abcc1 G T 16: 14,410,917 G343C probably damaging Het
Asic2 T C 11: 80,889,820 N370S probably benign Het
Btnl9 T C 11: 49,169,568 E451G probably damaging Het
Cblb A G 16: 52,174,370 H658R possibly damaging Het
Cdca2 T C 14: 67,680,284 E555G possibly damaging Het
Chfr A G 5: 110,153,129 S299G possibly damaging Het
Eea1 A G 10: 96,026,054 E741G probably benign Het
Gapvd1 T C 2: 34,693,433 D1057G probably benign Het
Glyat C T 19: 12,650,281 T80M probably benign Het
Gpr87 T C 3: 59,179,326 S253G probably damaging Het
Hmgxb3 A G 18: 61,162,977 S320P probably damaging Het
Kcnq5 C T 1: 21,479,468 G345D probably damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Madd G T 2: 91,170,635 T467K possibly damaging Het
Mamdc4 T C 2: 25,565,878 D706G probably damaging Het
Map2 A G 1: 66,413,133 H476R probably damaging Het
Mpeg1 T C 19: 12,461,693 S172P probably damaging Het
Nkx2-3 A T 19: 43,612,654 T52S probably benign Het
Nup210 C T 6: 91,085,988 V230I probably damaging Het
Olfr1009 G T 2: 85,722,322 A306S probably benign Het
Olfr348 T A 2: 36,787,181 Y219N probably damaging Het
Olfr568 T C 7: 102,877,893 S258P probably damaging Het
Pepd A G 7: 34,942,690 probably null Het
Ppp1r36 T A 12: 76,437,986 W238R probably damaging Het
Ppp1r36 G T 12: 76,437,987 W238L possibly damaging Het
Prpf6 T G 2: 181,608,165 D39E probably benign Het
Rassf5 T A 1: 131,181,195 Q163L possibly damaging Het
Rbm43 T A 2: 51,925,595 T205S probably benign Het
Robo4 CGG CG 9: 37,411,490 probably null Het
Sds C A 5: 120,483,650 Q286K possibly damaging Het
Slc35a3 A T 3: 116,681,190 C184* probably null Het
Smg1 G A 7: 118,139,436 T3530I possibly damaging Het
Sspo T C 6: 48,493,280 V591A probably benign Het
Stam2 T C 2: 52,720,917 D31G probably damaging Het
Star A G 8: 25,809,917 K96E probably damaging Het
Syne3 A G 12: 104,955,672 L495P probably damaging Het
Tceanc2 A T 4: 107,165,649 M47K probably benign Het
Tecpr2 T C 12: 110,914,684 L85P probably damaging Het
Tmem241 C T 18: 12,043,263 R116K probably benign Het
Yipf2 G A 9: 21,592,191 A20V probably benign Het
Zc3h4 T A 7: 16,429,005 D443E unknown Het
Zfp184 T A 13: 21,958,577 V151D probably benign Het
Zhx1 T C 15: 58,053,299 Y517C probably damaging Het
Other mutations in Kif5c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01064:Kif5c APN 2 49694816 missense possibly damaging 0.81
IGL01432:Kif5c APN 2 49701077 missense probably damaging 1.00
IGL01459:Kif5c APN 2 49735557 missense probably benign 0.36
IGL02127:Kif5c APN 2 49701110 splice site probably null
IGL03088:Kif5c APN 2 49744443 missense probably benign 0.01
IGL03379:Kif5c APN 2 49701092 missense probably damaging 0.97
IGL02988:Kif5c UTSW 2 49619717 missense probably damaging 0.97
PIT4131001:Kif5c UTSW 2 49694032 missense probably damaging 0.99
PIT4469001:Kif5c UTSW 2 49741348 missense probably benign 0.00
R0017:Kif5c UTSW 2 49732713 missense probably benign
R0017:Kif5c UTSW 2 49732713 missense probably benign
R0116:Kif5c UTSW 2 49752239 splice site probably benign
R0550:Kif5c UTSW 2 49758912 missense possibly damaging 0.53
R0760:Kif5c UTSW 2 49688753 missense probably damaging 1.00
R0967:Kif5c UTSW 2 49698116 unclassified probably benign
R1015:Kif5c UTSW 2 49744365 missense probably benign 0.13
R1758:Kif5c UTSW 2 49723133 missense probably benign 0.00
R1786:Kif5c UTSW 2 49758805 splice site probably benign
R1828:Kif5c UTSW 2 49680240 critical splice donor site probably null
R2130:Kif5c UTSW 2 49758805 splice site probably benign
R2132:Kif5c UTSW 2 49758805 splice site probably benign
R2237:Kif5c UTSW 2 49694008 missense probably benign 0.35
R3970:Kif5c UTSW 2 49688744 missense probably damaging 1.00
R4439:Kif5c UTSW 2 49688725 missense possibly damaging 0.90
R5260:Kif5c UTSW 2 49735590 missense probably damaging 0.99
R5318:Kif5c UTSW 2 49671828 missense probably benign
R5345:Kif5c UTSW 2 49723066 missense probably benign
R5496:Kif5c UTSW 2 49730190 missense possibly damaging 0.69
R5567:Kif5c UTSW 2 49730199 missense possibly damaging 0.64
R5570:Kif5c UTSW 2 49730199 missense possibly damaging 0.64
R6019:Kif5c UTSW 2 49735509 missense probably benign 0.09
R6688:Kif5c UTSW 2 49688737 missense probably benign 0.06
R7006:Kif5c UTSW 2 49735514 missense probably damaging 0.97
R7009:Kif5c UTSW 2 49757429 missense probably benign
R7081:Kif5c UTSW 2 49741361 missense probably benign 0.00
R7372:Kif5c UTSW 2 49758659 intron probably null
R7512:Kif5c UTSW 2 49700965 missense probably damaging 1.00
R7549:Kif5c UTSW 2 49701093 missense probably benign 0.11
R7764:Kif5c UTSW 2 49727961 critical splice donor site probably null
R7764:Kif5c UTSW 2 49749327 missense probably damaging 1.00
R7904:Kif5c UTSW 2 49701083 missense probably damaging 1.00
R8292:Kif5c UTSW 2 49735485 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- CCCTGAATTATGTGGGGTGTCC -3'
(R):5'- GGCCCAGATTTCTCTTACCTGG -3'

Sequencing Primer
(F):5'- CCTTAGTTTATTTTTCAGAGGCCAG -3'
(R):5'- CAGATTTCTCTTACCTGGATCCC -3'
Posted On2016-10-05