Incidental Mutation 'R5490:Olfr1009'
ID432028
Institutional Source Beutler Lab
Gene Symbol Olfr1009
Ensembl Gene ENSMUSG00000043226
Gene Nameolfactory receptor 1009
SynonymsMOR175-3, GA_x6K02T2Q125-47195323-47196267
MMRRC Submission 043051-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock #R5490 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location85715419-85725136 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 85722322 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 306 (A306S)
Ref Sequence ENSEMBL: ENSMUSP00000150450 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055517] [ENSMUST00000216443]
Predicted Effect probably benign
Transcript: ENSMUST00000055517
AA Change: A306S

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000061475
Gene: ENSMUSG00000043226
AA Change: A306S

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 3.4e-55 PFAM
Pfam:7tm_1 41 290 4.3e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213600
Predicted Effect probably benign
Transcript: ENSMUST00000216443
AA Change: A306S

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.3%
  • 10x: 95.2%
  • 20x: 90.8%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810013L24Rik T A 16: 8,855,857 V216E probably damaging Het
2310035C23Rik T A 1: 105,719,501 V672D probably damaging Het
4933406M09Rik A G 1: 134,389,928 D146G probably damaging Het
Aatf C T 11: 84,510,273 G174D probably damaging Het
Abcc1 G T 16: 14,410,917 G343C probably damaging Het
Asic2 T C 11: 80,889,820 N370S probably benign Het
Btnl9 T C 11: 49,169,568 E451G probably damaging Het
Cblb A G 16: 52,174,370 H658R possibly damaging Het
Cdca2 T C 14: 67,680,284 E555G possibly damaging Het
Chfr A G 5: 110,153,129 S299G possibly damaging Het
Eea1 A G 10: 96,026,054 E741G probably benign Het
Gapvd1 T C 2: 34,693,433 D1057G probably benign Het
Glyat C T 19: 12,650,281 T80M probably benign Het
Gpr87 T C 3: 59,179,326 S253G probably damaging Het
Hmgxb3 A G 18: 61,162,977 S320P probably damaging Het
Kcnq5 C T 1: 21,479,468 G345D probably damaging Het
Kif5c T C 2: 49,758,858 V938A probably benign Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Madd G T 2: 91,170,635 T467K possibly damaging Het
Mamdc4 T C 2: 25,565,878 D706G probably damaging Het
Map2 A G 1: 66,413,133 H476R probably damaging Het
Mpeg1 T C 19: 12,461,693 S172P probably damaging Het
Nkx2-3 A T 19: 43,612,654 T52S probably benign Het
Nup210 C T 6: 91,085,988 V230I probably damaging Het
Olfr348 T A 2: 36,787,181 Y219N probably damaging Het
Olfr568 T C 7: 102,877,893 S258P probably damaging Het
Pepd A G 7: 34,942,690 probably null Het
Ppp1r36 T A 12: 76,437,986 W238R probably damaging Het
Ppp1r36 G T 12: 76,437,987 W238L possibly damaging Het
Prpf6 T G 2: 181,608,165 D39E probably benign Het
Rassf5 T A 1: 131,181,195 Q163L possibly damaging Het
Rbm43 T A 2: 51,925,595 T205S probably benign Het
Robo4 CGG CG 9: 37,411,490 probably null Het
Sds C A 5: 120,483,650 Q286K possibly damaging Het
Slc35a3 A T 3: 116,681,190 C184* probably null Het
Smg1 G A 7: 118,139,436 T3530I possibly damaging Het
Sspo T C 6: 48,493,280 V591A probably benign Het
Stam2 T C 2: 52,720,917 D31G probably damaging Het
Star A G 8: 25,809,917 K96E probably damaging Het
Syne3 A G 12: 104,955,672 L495P probably damaging Het
Tceanc2 A T 4: 107,165,649 M47K probably benign Het
Tecpr2 T C 12: 110,914,684 L85P probably damaging Het
Tmem241 C T 18: 12,043,263 R116K probably benign Het
Yipf2 G A 9: 21,592,191 A20V probably benign Het
Zc3h4 T A 7: 16,429,005 D443E unknown Het
Zfp184 T A 13: 21,958,577 V151D probably benign Het
Zhx1 T C 15: 58,053,299 Y517C probably damaging Het
Other mutations in Olfr1009
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00920:Olfr1009 APN 2 85722239 missense probably damaging 1.00
IGL01862:Olfr1009 APN 2 85722128 missense probably damaging 0.99
IGL02868:Olfr1009 APN 2 85721575 missense probably benign 0.19
IGL02904:Olfr1009 APN 2 85721755 missense probably damaging 0.99
IGL03240:Olfr1009 APN 2 85722331 nonsense probably null
IGL03347:Olfr1009 APN 2 85721807 missense probably benign 0.01
R1148:Olfr1009 UTSW 2 85722276 nonsense probably null
R1148:Olfr1009 UTSW 2 85722276 nonsense probably null
R1446:Olfr1009 UTSW 2 85721573 missense probably damaging 0.99
R3782:Olfr1009 UTSW 2 85721696 missense probably damaging 1.00
R4343:Olfr1009 UTSW 2 85722248 missense probably damaging 1.00
R4836:Olfr1009 UTSW 2 85721449 missense probably benign
R4845:Olfr1009 UTSW 2 85721492 nonsense probably null
R5534:Olfr1009 UTSW 2 85721987 missense probably benign 0.35
R5679:Olfr1009 UTSW 2 85722046 missense probably damaging 1.00
R6476:Olfr1009 UTSW 2 85721584 missense probably damaging 1.00
R6701:Olfr1009 UTSW 2 85722331 missense probably benign 0.28
R7024:Olfr1009 UTSW 2 85721608 missense probably damaging 1.00
R7140:Olfr1009 UTSW 2 85721474 missense probably damaging 0.97
R7174:Olfr1009 UTSW 2 85721953 missense possibly damaging 0.81
R8079:Olfr1009 UTSW 2 85722043 missense probably benign 0.07
R8082:Olfr1009 UTSW 2 85721480 missense probably benign 0.01
R8213:Olfr1009 UTSW 2 85721501 missense probably null 1.00
X0020:Olfr1009 UTSW 2 85721978 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAGTTTCTATTTTGTACGGGACTC -3'
(R):5'- GCTAAGCAAAACACTCTGCTTG -3'

Sequencing Primer
(F):5'- CTCTTCTTTATCTATGTGAGGCCAAG -3'
(R):5'- GCAAAACACTCTGCTTGTTATTTTC -3'
Posted On2016-10-05