Incidental Mutation 'R5490:Gpr87'
ID432031
Institutional Source Beutler Lab
Gene Symbol Gpr87
Ensembl Gene ENSMUSG00000051431
Gene NameG protein-coupled receptor 87
Synonyms
MMRRC Submission 043051-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5490 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location59178923-59195104 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 59179326 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 253 (S253G)
Ref Sequence ENSEMBL: ENSMUSP00000143683 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040325] [ENSMUST00000056898] [ENSMUST00000164225] [ENSMUST00000199659] [ENSMUST00000200095]
Predicted Effect probably benign
Transcript: ENSMUST00000040325
SMART Domains Protein: ENSMUSP00000042269
Gene: ENSMUSG00000056476

DomainStartEndE-ValueType
Med12 101 161 1.71e-24 SMART
low complexity region 216 224 N/A INTRINSIC
low complexity region 269 278 N/A INTRINSIC
Pfam:Med12-LCEWAV 282 730 2.6e-207 PFAM
low complexity region 744 758 N/A INTRINSIC
low complexity region 853 872 N/A INTRINSIC
low complexity region 1455 1466 N/A INTRINSIC
low complexity region 1728 1742 N/A INTRINSIC
low complexity region 1769 1783 N/A INTRINSIC
Pfam:Med12-PQL 1803 2029 2.3e-14 PFAM
low complexity region 2055 2076 N/A INTRINSIC
low complexity region 2083 2101 N/A INTRINSIC
low complexity region 2116 2136 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000056898
AA Change: S254G

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000059272
Gene: ENSMUSG00000051431
AA Change: S254G

DomainStartEndE-ValueType
Pfam:7tm_1 60 315 1.4e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164225
SMART Domains Protein: ENSMUSP00000127038
Gene: ENSMUSG00000056476

DomainStartEndE-ValueType
Med12 101 161 1.71e-24 SMART
low complexity region 216 224 N/A INTRINSIC
low complexity region 269 278 N/A INTRINSIC
Pfam:Med12-LCEWAV 283 765 5e-187 PFAM
low complexity region 779 793 N/A INTRINSIC
low complexity region 888 907 N/A INTRINSIC
low complexity region 1490 1501 N/A INTRINSIC
low complexity region 1763 1777 N/A INTRINSIC
low complexity region 1804 1818 N/A INTRINSIC
Pfam:Med12-PQL 1840 2063 9.7e-66 PFAM
low complexity region 2090 2111 N/A INTRINSIC
low complexity region 2118 2136 N/A INTRINSIC
low complexity region 2151 2171 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000199659
SMART Domains Protein: ENSMUSP00000142903
Gene: ENSMUSG00000056476

DomainStartEndE-ValueType
Med12 101 161 1.71e-24 SMART
low complexity region 216 224 N/A INTRINSIC
low complexity region 269 278 N/A INTRINSIC
Pfam:Med12-LCEWAV 282 765 5.5e-209 PFAM
low complexity region 779 793 N/A INTRINSIC
low complexity region 888 907 N/A INTRINSIC
low complexity region 1490 1501 N/A INTRINSIC
low complexity region 1761 1775 N/A INTRINSIC
low complexity region 1802 1816 N/A INTRINSIC
Pfam:Med12-PQL 1836 2062 1.7e-15 PFAM
low complexity region 2088 2130 N/A INTRINSIC
low complexity region 2144 2164 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199833
Predicted Effect probably damaging
Transcript: ENSMUST00000200095
AA Change: S253G

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000143683
Gene: ENSMUSG00000051431
AA Change: S253G

DomainStartEndE-ValueType
Pfam:7tm_1 59 314 3.5e-37 PFAM
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.3%
  • 10x: 95.2%
  • 20x: 90.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a G protein-coupled receptor and is located in a cluster of G protein-couple receptor genes on chromosome 3. The encoded protein has been shown to be overexpressed in lung squamous cell carcinoma (PMID:18057535) and regulated by p53 (PMID:19602589). [provided by RefSeq, Nov 2011]
PHENOTYPE: Mice homozygous for a null allele exhibit decreased mean vertebral and femoral bone measurements. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810013L24Rik T A 16: 8,855,857 V216E probably damaging Het
2310035C23Rik T A 1: 105,719,501 V672D probably damaging Het
4933406M09Rik A G 1: 134,389,928 D146G probably damaging Het
Aatf C T 11: 84,510,273 G174D probably damaging Het
Abcc1 G T 16: 14,410,917 G343C probably damaging Het
Asic2 T C 11: 80,889,820 N370S probably benign Het
Btnl9 T C 11: 49,169,568 E451G probably damaging Het
Cblb A G 16: 52,174,370 H658R possibly damaging Het
Cdca2 T C 14: 67,680,284 E555G possibly damaging Het
Chfr A G 5: 110,153,129 S299G possibly damaging Het
Eea1 A G 10: 96,026,054 E741G probably benign Het
Gapvd1 T C 2: 34,693,433 D1057G probably benign Het
Glyat C T 19: 12,650,281 T80M probably benign Het
Hmgxb3 A G 18: 61,162,977 S320P probably damaging Het
Kcnq5 C T 1: 21,479,468 G345D probably damaging Het
Kif5c T C 2: 49,758,858 V938A probably benign Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Madd G T 2: 91,170,635 T467K possibly damaging Het
Mamdc4 T C 2: 25,565,878 D706G probably damaging Het
Map2 A G 1: 66,413,133 H476R probably damaging Het
Mpeg1 T C 19: 12,461,693 S172P probably damaging Het
Nkx2-3 A T 19: 43,612,654 T52S probably benign Het
Nup210 C T 6: 91,085,988 V230I probably damaging Het
Olfr1009 G T 2: 85,722,322 A306S probably benign Het
Olfr348 T A 2: 36,787,181 Y219N probably damaging Het
Olfr568 T C 7: 102,877,893 S258P probably damaging Het
Pepd A G 7: 34,942,690 probably null Het
Ppp1r36 T A 12: 76,437,986 W238R probably damaging Het
Ppp1r36 G T 12: 76,437,987 W238L possibly damaging Het
Prpf6 T G 2: 181,608,165 D39E probably benign Het
Rassf5 T A 1: 131,181,195 Q163L possibly damaging Het
Rbm43 T A 2: 51,925,595 T205S probably benign Het
Robo4 CGG CG 9: 37,411,490 probably null Het
Sds C A 5: 120,483,650 Q286K possibly damaging Het
Slc35a3 A T 3: 116,681,190 C184* probably null Het
Smg1 G A 7: 118,139,436 T3530I possibly damaging Het
Sspo T C 6: 48,493,280 V591A probably benign Het
Stam2 T C 2: 52,720,917 D31G probably damaging Het
Star A G 8: 25,809,917 K96E probably damaging Het
Syne3 A G 12: 104,955,672 L495P probably damaging Het
Tceanc2 A T 4: 107,165,649 M47K probably benign Het
Tecpr2 T C 12: 110,914,684 L85P probably damaging Het
Tmem241 C T 18: 12,043,263 R116K probably benign Het
Yipf2 G A 9: 21,592,191 A20V probably benign Het
Zc3h4 T A 7: 16,429,005 D443E unknown Het
Zfp184 T A 13: 21,958,577 V151D probably benign Het
Zhx1 T C 15: 58,053,299 Y517C probably damaging Het
Other mutations in Gpr87
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00496:Gpr87 APN 3 59179790 missense probably damaging 1.00
IGL02309:Gpr87 APN 3 59179554 missense possibly damaging 0.74
IGL02614:Gpr87 APN 3 59179317 missense probably damaging 1.00
R0097:Gpr87 UTSW 3 59179085 missense probably damaging 1.00
R0097:Gpr87 UTSW 3 59179085 missense probably damaging 1.00
R0113:Gpr87 UTSW 3 59179511 missense possibly damaging 0.86
R1801:Gpr87 UTSW 3 59179392 missense possibly damaging 0.92
R2213:Gpr87 UTSW 3 59179044 missense probably damaging 0.99
R2698:Gpr87 UTSW 3 59179166 missense probably damaging 1.00
R5459:Gpr87 UTSW 3 59179727 missense possibly damaging 0.89
R5963:Gpr87 UTSW 3 59179269 nonsense probably null
R6189:Gpr87 UTSW 3 59179229 missense probably damaging 1.00
R6251:Gpr87 UTSW 3 59179107 missense probably damaging 0.99
R7863:Gpr87 UTSW 3 59179896 missense probably damaging 1.00
R8008:Gpr87 UTSW 3 59180045 missense probably benign
R8065:Gpr87 UTSW 3 59179887 missense probably damaging 1.00
R8067:Gpr87 UTSW 3 59179887 missense probably damaging 1.00
R8096:Gpr87 UTSW 3 59179808 missense possibly damaging 0.70
R8141:Gpr87 UTSW 3 59179599 missense probably damaging 1.00
R8326:Gpr87 UTSW 3 59194974 start gained probably benign
Z1177:Gpr87 UTSW 3 59180070 missense probably benign
Predicted Primers PCR Primer
(F):5'- AATTATCGGATCCAGGCACAC -3'
(R):5'- TAATGGGCAGCCAACTAAGG -3'

Sequencing Primer
(F):5'- CGTTGCACGCAGACAAG -3'
(R):5'- TGCATGAAACTCAAAAGTCCGCTG -3'
Posted On2016-10-05