Incidental Mutation 'R5490:Slc35a3'
ID432032
Institutional Source Beutler Lab
Gene Symbol Slc35a3
Ensembl Gene ENSMUSG00000027957
Gene Namesolute carrier family 35 (UDP-N-acetylglucosamine (UDP-GlcNAc) transporter), member 3
Synonyms2310050P13Rik
MMRRC Submission 043051-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.082) question?
Stock #R5490 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location116669470-116712831 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 116681190 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 184 (C184*)
Ref Sequence ENSEMBL: ENSMUSP00000123641 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029569] [ENSMUST00000120120] [ENSMUST00000153108] [ENSMUST00000196335]
Predicted Effect probably null
Transcript: ENSMUST00000029569
AA Change: C184*
SMART Domains Protein: ENSMUSP00000029569
Gene: ENSMUSG00000027957
AA Change: C184*

DomainStartEndE-ValueType
Pfam:Nuc_sug_transp 1 314 2.3e-141 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000120120
AA Change: C184*
SMART Domains Protein: ENSMUSP00000112674
Gene: ENSMUSG00000027957
AA Change: C184*

DomainStartEndE-ValueType
Pfam:UAA 13 320 1.4e-11 PFAM
Pfam:EamA 29 156 2.1e-8 PFAM
Pfam:TPT 38 154 1.2e-7 PFAM
Pfam:Nuc_sug_transp 68 306 6.3e-105 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000140672
AA Change: C23*
SMART Domains Protein: ENSMUSP00000114952
Gene: ENSMUSG00000105103
AA Change: C23*

DomainStartEndE-ValueType
Pfam:Nuc_sug_transp 2 129 2.4e-39 PFAM
Pfam:MFS_1 104 235 1e-13 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000153108
AA Change: C184*
SMART Domains Protein: ENSMUSP00000123641
Gene: ENSMUSG00000027957
AA Change: C184*

DomainStartEndE-ValueType
Pfam:UAA 10 209 1.6e-10 PFAM
Pfam:EamA 27 156 6.2e-9 PFAM
Pfam:TPT 37 154 3.2e-8 PFAM
Pfam:Nuc_sug_transp 68 212 1.6e-65 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196331
Predicted Effect probably benign
Transcript: ENSMUST00000196335
SMART Domains Protein: ENSMUSP00000142374
Gene: ENSMUSG00000027957

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:EamA 29 156 6.8e-7 PFAM
Pfam:TPT 34 154 1.6e-6 PFAM
Pfam:Nuc_sug_transp 68 167 5.9e-40 PFAM
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.3%
  • 10x: 95.2%
  • 20x: 90.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a UDP-N-acetylglucosamine transporter found in the golgi apparatus membrane. In cattle, a missense mutation in this gene causes complex vertebral malformation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2012]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810013L24Rik T A 16: 8,855,857 V216E probably damaging Het
2310035C23Rik T A 1: 105,719,501 V672D probably damaging Het
4933406M09Rik A G 1: 134,389,928 D146G probably damaging Het
Aatf C T 11: 84,510,273 G174D probably damaging Het
Abcc1 G T 16: 14,410,917 G343C probably damaging Het
Asic2 T C 11: 80,889,820 N370S probably benign Het
Btnl9 T C 11: 49,169,568 E451G probably damaging Het
Cblb A G 16: 52,174,370 H658R possibly damaging Het
Cdca2 T C 14: 67,680,284 E555G possibly damaging Het
Chfr A G 5: 110,153,129 S299G possibly damaging Het
Eea1 A G 10: 96,026,054 E741G probably benign Het
Gapvd1 T C 2: 34,693,433 D1057G probably benign Het
Glyat C T 19: 12,650,281 T80M probably benign Het
Gpr87 T C 3: 59,179,326 S253G probably damaging Het
Hmgxb3 A G 18: 61,162,977 S320P probably damaging Het
Kcnq5 C T 1: 21,479,468 G345D probably damaging Het
Kif5c T C 2: 49,758,858 V938A probably benign Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Madd G T 2: 91,170,635 T467K possibly damaging Het
Mamdc4 T C 2: 25,565,878 D706G probably damaging Het
Map2 A G 1: 66,413,133 H476R probably damaging Het
Mpeg1 T C 19: 12,461,693 S172P probably damaging Het
Nkx2-3 A T 19: 43,612,654 T52S probably benign Het
Nup210 C T 6: 91,085,988 V230I probably damaging Het
Olfr1009 G T 2: 85,722,322 A306S probably benign Het
Olfr348 T A 2: 36,787,181 Y219N probably damaging Het
Olfr568 T C 7: 102,877,893 S258P probably damaging Het
Pepd A G 7: 34,942,690 probably null Het
Ppp1r36 T A 12: 76,437,986 W238R probably damaging Het
Ppp1r36 G T 12: 76,437,987 W238L possibly damaging Het
Prpf6 T G 2: 181,608,165 D39E probably benign Het
Rassf5 T A 1: 131,181,195 Q163L possibly damaging Het
Rbm43 T A 2: 51,925,595 T205S probably benign Het
Robo4 CGG CG 9: 37,411,490 probably null Het
Sds C A 5: 120,483,650 Q286K possibly damaging Het
Smg1 G A 7: 118,139,436 T3530I possibly damaging Het
Sspo T C 6: 48,493,280 V591A probably benign Het
Stam2 T C 2: 52,720,917 D31G probably damaging Het
Star A G 8: 25,809,917 K96E probably damaging Het
Syne3 A G 12: 104,955,672 L495P probably damaging Het
Tceanc2 A T 4: 107,165,649 M47K probably benign Het
Tecpr2 T C 12: 110,914,684 L85P probably damaging Het
Tmem241 C T 18: 12,043,263 R116K probably benign Het
Yipf2 G A 9: 21,592,191 A20V probably benign Het
Zc3h4 T A 7: 16,429,005 D443E unknown Het
Zfp184 T A 13: 21,958,577 V151D probably benign Het
Zhx1 T C 15: 58,053,299 Y517C probably damaging Het
Other mutations in Slc35a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01285:Slc35a3 APN 3 116694613 missense probably damaging 1.00
IGL02092:Slc35a3 APN 3 116681132 missense probably damaging 1.00
IGL02424:Slc35a3 APN 3 116694618 missense possibly damaging 0.92
IGL03304:Slc35a3 APN 3 116687311 missense probably damaging 1.00
R1465:Slc35a3 UTSW 3 116687334 missense probably benign 0.44
R1465:Slc35a3 UTSW 3 116687334 missense probably benign 0.44
R1753:Slc35a3 UTSW 3 116677948 missense possibly damaging 0.79
R2035:Slc35a3 UTSW 3 116687323 missense probably damaging 1.00
R2265:Slc35a3 UTSW 3 116673636 missense possibly damaging 0.87
R2266:Slc35a3 UTSW 3 116673636 missense possibly damaging 0.87
R2267:Slc35a3 UTSW 3 116673636 missense possibly damaging 0.87
R2268:Slc35a3 UTSW 3 116673636 missense possibly damaging 0.87
R4073:Slc35a3 UTSW 3 116675238 missense probably benign 0.05
R5187:Slc35a3 UTSW 3 116681145 missense probably damaging 1.00
R6841:Slc35a3 UTSW 3 116712768 missense probably null
R7270:Slc35a3 UTSW 3 116711806 intron probably benign
R7964:Slc35a3 UTSW 3 116687335 missense possibly damaging 0.56
R8747:Slc35a3 UTSW 3 116694570 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTGAAAGACTTAGGGAGATCCAC -3'
(R):5'- AGCTTACCTTCTGCTCAGGC -3'

Sequencing Primer
(F):5'- AAGATGCGGTCTCCCTATGTG -3'
(R):5'- AGGGCACAGACTCAGGTTGTC -3'
Posted On2016-10-05