Incidental Mutation 'R5490:Robo4'
ID432046
Institutional Source Beutler Lab
Gene Symbol Robo4
Ensembl Gene ENSMUSG00000032125
Gene Nameroundabout guidance receptor 4
Synonyms1200012D01Rik, Magic roundabout
MMRRC Submission 043051-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.223) question?
Stock #R5490 (G1)
Quality Score217
Status Not validated
Chromosome9
Chromosomal Location37401897-37415115 bp(+) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) CGG to CG at 37411490 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000150722 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034643] [ENSMUST00000102895] [ENSMUST00000115038] [ENSMUST00000115046] [ENSMUST00000115048] [ENSMUST00000156972] [ENSMUST00000170512] [ENSMUST00000214185]
Predicted Effect probably benign
Transcript: ENSMUST00000034643
SMART Domains Protein: ENSMUSP00000034643
Gene: ENSMUSG00000032128

DomainStartEndE-ValueType
IGc2 54 128 9.7e-11 SMART
IGc2 156 221 1.44e-4 SMART
IGc2 248 311 1.89e-13 SMART
IGc2 337 409 9.84e-12 SMART
IGc2 441 506 2.09e-15 SMART
FN3 534 616 4.24e-14 SMART
FN3 648 731 3.06e0 SMART
FN3 747 832 1.97e-9 SMART
low complexity region 870 890 N/A INTRINSIC
low complexity region 1055 1082 N/A INTRINSIC
low complexity region 1131 1149 N/A INTRINSIC
low complexity region 1155 1169 N/A INTRINSIC
low complexity region 1193 1206 N/A INTRINSIC
low complexity region 1245 1256 N/A INTRINSIC
low complexity region 1268 1281 N/A INTRINSIC
low complexity region 1336 1376 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000102895
SMART Domains Protein: ENSMUSP00000099959
Gene: ENSMUSG00000032125

DomainStartEndE-ValueType
signal peptide 1 37 N/A INTRINSIC
IG 48 144 2.51e0 SMART
IGc2 160 225 6.86e-11 SMART
FN3 263 343 2.05e0 SMART
FN3 358 440 1.27e-3 SMART
low complexity region 488 494 N/A INTRINSIC
low complexity region 544 562 N/A INTRINSIC
low complexity region 720 733 N/A INTRINSIC
low complexity region 748 762 N/A INTRINSIC
low complexity region 775 799 N/A INTRINSIC
low complexity region 855 866 N/A INTRINSIC
low complexity region 871 880 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115038
SMART Domains Protein: ENSMUSP00000110690
Gene: ENSMUSG00000032128

DomainStartEndE-ValueType
low complexity region 34 47 N/A INTRINSIC
IGc2 76 150 9.7e-11 SMART
IGc2 178 243 1.44e-4 SMART
IGc2 270 333 1.89e-13 SMART
IGc2 359 431 9.84e-12 SMART
IGc2 463 528 2.09e-15 SMART
FN3 556 638 4.24e-14 SMART
FN3 670 753 3.06e0 SMART
FN3 769 854 1.97e-9 SMART
low complexity region 892 912 N/A INTRINSIC
low complexity region 1077 1104 N/A INTRINSIC
low complexity region 1153 1171 N/A INTRINSIC
low complexity region 1177 1191 N/A INTRINSIC
low complexity region 1215 1228 N/A INTRINSIC
low complexity region 1267 1278 N/A INTRINSIC
low complexity region 1290 1303 N/A INTRINSIC
low complexity region 1358 1398 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000115046
SMART Domains Protein: ENSMUSP00000110698
Gene: ENSMUSG00000032125

DomainStartEndE-ValueType
signal peptide 1 37 N/A INTRINSIC
IG 48 144 2.51e0 SMART
IGc2 160 225 6.86e-11 SMART
FN3 263 343 2.05e0 SMART
FN3 358 440 1.27e-3 SMART
low complexity region 484 500 N/A INTRINSIC
low complexity region 540 546 N/A INTRINSIC
low complexity region 596 614 N/A INTRINSIC
low complexity region 747 756 N/A INTRINSIC
low complexity region 779 792 N/A INTRINSIC
low complexity region 807 821 N/A INTRINSIC
low complexity region 834 858 N/A INTRINSIC
low complexity region 914 925 N/A INTRINSIC
low complexity region 930 939 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000115048
SMART Domains Protein: ENSMUSP00000110700
Gene: ENSMUSG00000032125

DomainStartEndE-ValueType
signal peptide 1 37 N/A INTRINSIC
IG 48 144 2.51e0 SMART
IGc2 160 225 6.86e-11 SMART
FN3 263 343 2.05e0 SMART
FN3 358 440 1.27e-3 SMART
low complexity region 488 494 N/A INTRINSIC
low complexity region 544 562 N/A INTRINSIC
low complexity region 695 704 N/A INTRINSIC
low complexity region 727 740 N/A INTRINSIC
low complexity region 755 769 N/A INTRINSIC
low complexity region 782 806 N/A INTRINSIC
low complexity region 862 873 N/A INTRINSIC
low complexity region 878 887 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000156972
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167089
Predicted Effect probably benign
Transcript: ENSMUST00000170512
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171467
Predicted Effect probably null
Transcript: ENSMUST00000214185
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215777
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.3%
  • 10x: 95.2%
  • 20x: 90.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a reporter/null allele display enhanced VEGF-induced endothelial migration, tube formation and vascular permeability, and show increased pathologic angiogenesis and vascular leak in models of oxygen-induced retinopathy and choroidal neovascularization. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810013L24Rik T A 16: 8,855,857 V216E probably damaging Het
2310035C23Rik T A 1: 105,719,501 V672D probably damaging Het
4933406M09Rik A G 1: 134,389,928 D146G probably damaging Het
Aatf C T 11: 84,510,273 G174D probably damaging Het
Abcc1 G T 16: 14,410,917 G343C probably damaging Het
Asic2 T C 11: 80,889,820 N370S probably benign Het
Btnl9 T C 11: 49,169,568 E451G probably damaging Het
Cblb A G 16: 52,174,370 H658R possibly damaging Het
Cdca2 T C 14: 67,680,284 E555G possibly damaging Het
Chfr A G 5: 110,153,129 S299G possibly damaging Het
Eea1 A G 10: 96,026,054 E741G probably benign Het
Gapvd1 T C 2: 34,693,433 D1057G probably benign Het
Glyat C T 19: 12,650,281 T80M probably benign Het
Gpr87 T C 3: 59,179,326 S253G probably damaging Het
Hmgxb3 A G 18: 61,162,977 S320P probably damaging Het
Kcnq5 C T 1: 21,479,468 G345D probably damaging Het
Kif5c T C 2: 49,758,858 V938A probably benign Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Madd G T 2: 91,170,635 T467K possibly damaging Het
Mamdc4 T C 2: 25,565,878 D706G probably damaging Het
Map2 A G 1: 66,413,133 H476R probably damaging Het
Mpeg1 T C 19: 12,461,693 S172P probably damaging Het
Nkx2-3 A T 19: 43,612,654 T52S probably benign Het
Nup210 C T 6: 91,085,988 V230I probably damaging Het
Olfr1009 G T 2: 85,722,322 A306S probably benign Het
Olfr348 T A 2: 36,787,181 Y219N probably damaging Het
Olfr568 T C 7: 102,877,893 S258P probably damaging Het
Pepd A G 7: 34,942,690 probably null Het
Ppp1r36 T A 12: 76,437,986 W238R probably damaging Het
Ppp1r36 G T 12: 76,437,987 W238L possibly damaging Het
Prpf6 T G 2: 181,608,165 D39E probably benign Het
Rassf5 T A 1: 131,181,195 Q163L possibly damaging Het
Rbm43 T A 2: 51,925,595 T205S probably benign Het
Sds C A 5: 120,483,650 Q286K possibly damaging Het
Slc35a3 A T 3: 116,681,190 C184* probably null Het
Smg1 G A 7: 118,139,436 T3530I possibly damaging Het
Sspo T C 6: 48,493,280 V591A probably benign Het
Stam2 T C 2: 52,720,917 D31G probably damaging Het
Star A G 8: 25,809,917 K96E probably damaging Het
Syne3 A G 12: 104,955,672 L495P probably damaging Het
Tceanc2 A T 4: 107,165,649 M47K probably benign Het
Tecpr2 T C 12: 110,914,684 L85P probably damaging Het
Tmem241 C T 18: 12,043,263 R116K probably benign Het
Yipf2 G A 9: 21,592,191 A20V probably benign Het
Zc3h4 T A 7: 16,429,005 D443E unknown Het
Zfp184 T A 13: 21,958,577 V151D probably benign Het
Zhx1 T C 15: 58,053,299 Y517C probably damaging Het
Other mutations in Robo4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Robo4 APN 9 37411104 missense probably damaging 1.00
IGL00392:Robo4 APN 9 37408229 missense probably damaging 1.00
IGL00491:Robo4 APN 9 37405935 missense possibly damaging 0.52
IGL00792:Robo4 APN 9 37408211 missense probably damaging 1.00
IGL01062:Robo4 APN 9 37406000 missense probably benign 0.08
IGL01287:Robo4 APN 9 37413040 missense possibly damaging 0.96
IGL02289:Robo4 APN 9 37408200 missense probably damaging 1.00
IGL02486:Robo4 APN 9 37408374 missense probably damaging 1.00
IGL02851:Robo4 APN 9 37413382 missense probably damaging 0.96
IGL02898:Robo4 APN 9 37408176 missense probably damaging 0.99
IGL02965:Robo4 APN 9 37410469 missense possibly damaging 0.82
IGL03071:Robo4 APN 9 37404284 splice site probably benign
IGL03102:Robo4 APN 9 37404185 missense probably damaging 1.00
H8562:Robo4 UTSW 9 37405810 intron probably benign
PIT4305001:Robo4 UTSW 9 37411391 missense probably damaging 1.00
R0056:Robo4 UTSW 9 37404477 missense probably benign 0.03
R0068:Robo4 UTSW 9 37404477 missense probably benign 0.03
R0233:Robo4 UTSW 9 37402681 missense probably damaging 1.00
R0233:Robo4 UTSW 9 37402681 missense probably damaging 1.00
R0416:Robo4 UTSW 9 37404766 splice site probably benign
R1005:Robo4 UTSW 9 37408251 missense probably damaging 1.00
R1174:Robo4 UTSW 9 37413052 missense probably damaging 1.00
R1183:Robo4 UTSW 9 37408052 missense probably damaging 1.00
R1254:Robo4 UTSW 9 37410840 critical splice donor site probably null
R1398:Robo4 UTSW 9 37408076 critical splice donor site probably null
R1505:Robo4 UTSW 9 37403227 missense probably damaging 0.98
R1701:Robo4 UTSW 9 37403443 missense probably benign 0.44
R1834:Robo4 UTSW 9 37413059 missense probably benign 0.09
R1899:Robo4 UTSW 9 37404070 splice site probably benign
R2203:Robo4 UTSW 9 37411490 frame shift probably null
R2204:Robo4 UTSW 9 37411490 frame shift probably null
R2351:Robo4 UTSW 9 37411660 missense probably benign 0.01
R2448:Robo4 UTSW 9 37402662 missense possibly damaging 0.96
R2847:Robo4 UTSW 9 37404476 nonsense probably null
R2851:Robo4 UTSW 9 37411490 frame shift probably null
R2852:Robo4 UTSW 9 37411490 frame shift probably null
R2877:Robo4 UTSW 9 37411490 frame shift probably null
R3123:Robo4 UTSW 9 37411490 frame shift probably null
R3124:Robo4 UTSW 9 37411490 frame shift probably null
R3125:Robo4 UTSW 9 37411490 frame shift probably null
R3805:Robo4 UTSW 9 37404438 missense possibly damaging 0.73
R3806:Robo4 UTSW 9 37404438 missense possibly damaging 0.73
R3892:Robo4 UTSW 9 37411490 frame shift probably null
R3905:Robo4 UTSW 9 37403505 nonsense probably null
R3938:Robo4 UTSW 9 37402017 start gained probably benign
R4261:Robo4 UTSW 9 37405581 missense probably benign 0.04
R4434:Robo4 UTSW 9 37411490 frame shift probably null
R4435:Robo4 UTSW 9 37411490 frame shift probably null
R4561:Robo4 UTSW 9 37411490 frame shift probably null
R4562:Robo4 UTSW 9 37411490 frame shift probably null
R4568:Robo4 UTSW 9 37404822 missense possibly damaging 0.59
R4695:Robo4 UTSW 9 37403199 missense probably damaging 1.00
R4921:Robo4 UTSW 9 37402560 missense probably benign
R5000:Robo4 UTSW 9 37408368 missense probably benign 0.02
R5056:Robo4 UTSW 9 37404806 missense probably benign 0.00
R5125:Robo4 UTSW 9 37407960 missense probably damaging 1.00
R5178:Robo4 UTSW 9 37407960 missense probably damaging 1.00
R5278:Robo4 UTSW 9 37411490 frame shift probably null
R5279:Robo4 UTSW 9 37411490 frame shift probably null
R5285:Robo4 UTSW 9 37411490 frame shift probably null
R5347:Robo4 UTSW 9 37411490 frame shift probably null
R5348:Robo4 UTSW 9 37411490 frame shift probably null
R5361:Robo4 UTSW 9 37413378 missense probably benign 0.01
R5403:Robo4 UTSW 9 37411490 frame shift probably null
R5404:Robo4 UTSW 9 37411490 frame shift probably null
R5488:Robo4 UTSW 9 37411490 frame shift probably null
R5489:Robo4 UTSW 9 37411490 frame shift probably null
R5494:Robo4 UTSW 9 37411490 frame shift probably null
R5629:Robo4 UTSW 9 37408362 missense probably damaging 1.00
R5736:Robo4 UTSW 9 37404797 missense possibly damaging 0.63
R5796:Robo4 UTSW 9 37411674 missense probably benign 0.00
R5987:Robo4 UTSW 9 37411400 missense probably damaging 1.00
R6178:Robo4 UTSW 9 37405630 nonsense probably null
R6189:Robo4 UTSW 9 37403533 missense probably benign 0.35
R6365:Robo4 UTSW 9 37410712 missense probably benign 0.34
R6528:Robo4 UTSW 9 37404368 missense possibly damaging 0.92
R6887:Robo4 UTSW 9 37402067 missense possibly damaging 0.82
R7196:Robo4 UTSW 9 37402705 missense possibly damaging 0.92
R7408:Robo4 UTSW 9 37410981 missense probably benign 0.09
R7419:Robo4 UTSW 9 37402809 missense probably benign 0.18
R7486:Robo4 UTSW 9 37405574 missense probably damaging 0.99
R7707:Robo4 UTSW 9 37413122 missense probably damaging 1.00
R7839:Robo4 UTSW 9 37410759 missense probably damaging 1.00
R8079:Robo4 UTSW 9 37402635 missense possibly damaging 0.82
R8081:Robo4 UTSW 9 37405640 missense probably damaging 0.99
R8280:Robo4 UTSW 9 37404076 missense probably benign 0.00
R8526:Robo4 UTSW 9 37403505 nonsense probably null
R8547:Robo4 UTSW 9 37404378 missense possibly damaging 0.69
R8735:Robo4 UTSW 9 37408281 missense possibly damaging 0.92
R8836:Robo4 UTSW 9 37405834 missense unknown
Predicted Primers PCR Primer
(F):5'- ACTGTGCCCTAACCAGTGTC -3'
(R):5'- TGAAGACACAGTCAGCTTCCC -3'

Sequencing Primer
(F):5'- GTGCCCTAACCAGTGTCCTGTC -3'
(R):5'- ACAGTCAGCTTCCCTGGGATC -3'
Posted On2016-10-05