Incidental Mutation 'R5490:Eea1'
ID432047
Institutional Source Beutler Lab
Gene Symbol Eea1
Ensembl Gene ENSMUSG00000036499
Gene Nameearly endosome antigen 1
SynonymsZFYVE2, B230358H09Rik, A430109M19Rik
MMRRC Submission 043051-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.191) question?
Stock #R5490 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location95940650-96045518 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 96026054 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 741 (E741G)
Ref Sequence ENSEMBL: ENSMUSP00000061493 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053484] [ENSMUST00000218291]
Predicted Effect probably benign
Transcript: ENSMUST00000053484
AA Change: E741G

PolyPhen 2 Score 0.406 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000061493
Gene: ENSMUSG00000036499
AA Change: E741G

DomainStartEndE-ValueType
ZnF_C2H2 41 64 2.2e-2 SMART
low complexity region 98 123 N/A INTRINSIC
low complexity region 135 148 N/A INTRINSIC
low complexity region 389 408 N/A INTRINSIC
low complexity region 480 500 N/A INTRINSIC
low complexity region 573 585 N/A INTRINSIC
low complexity region 616 630 N/A INTRINSIC
low complexity region 645 660 N/A INTRINSIC
low complexity region 748 760 N/A INTRINSIC
low complexity region 909 924 N/A INTRINSIC
low complexity region 947 958 N/A INTRINSIC
low complexity region 996 1010 N/A INTRINSIC
low complexity region 1165 1176 N/A INTRINSIC
low complexity region 1198 1217 N/A INTRINSIC
FYVE 1344 1411 1.99e-28 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218088
Predicted Effect probably benign
Transcript: ENSMUST00000218291
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.3%
  • 10x: 95.2%
  • 20x: 90.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810013L24Rik T A 16: 8,855,857 V216E probably damaging Het
2310035C23Rik T A 1: 105,719,501 V672D probably damaging Het
4933406M09Rik A G 1: 134,389,928 D146G probably damaging Het
Aatf C T 11: 84,510,273 G174D probably damaging Het
Abcc1 G T 16: 14,410,917 G343C probably damaging Het
Asic2 T C 11: 80,889,820 N370S probably benign Het
Btnl9 T C 11: 49,169,568 E451G probably damaging Het
Cblb A G 16: 52,174,370 H658R possibly damaging Het
Cdca2 T C 14: 67,680,284 E555G possibly damaging Het
Chfr A G 5: 110,153,129 S299G possibly damaging Het
Gapvd1 T C 2: 34,693,433 D1057G probably benign Het
Glyat C T 19: 12,650,281 T80M probably benign Het
Gpr87 T C 3: 59,179,326 S253G probably damaging Het
Hmgxb3 A G 18: 61,162,977 S320P probably damaging Het
Kcnq5 C T 1: 21,479,468 G345D probably damaging Het
Kif5c T C 2: 49,758,858 V938A probably benign Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Madd G T 2: 91,170,635 T467K possibly damaging Het
Mamdc4 T C 2: 25,565,878 D706G probably damaging Het
Map2 A G 1: 66,413,133 H476R probably damaging Het
Mpeg1 T C 19: 12,461,693 S172P probably damaging Het
Nkx2-3 A T 19: 43,612,654 T52S probably benign Het
Nup210 C T 6: 91,085,988 V230I probably damaging Het
Olfr1009 G T 2: 85,722,322 A306S probably benign Het
Olfr348 T A 2: 36,787,181 Y219N probably damaging Het
Olfr568 T C 7: 102,877,893 S258P probably damaging Het
Pepd A G 7: 34,942,690 probably null Het
Ppp1r36 T A 12: 76,437,986 W238R probably damaging Het
Ppp1r36 G T 12: 76,437,987 W238L possibly damaging Het
Prpf6 T G 2: 181,608,165 D39E probably benign Het
Rassf5 T A 1: 131,181,195 Q163L possibly damaging Het
Rbm43 T A 2: 51,925,595 T205S probably benign Het
Robo4 CGG CG 9: 37,411,490 probably null Het
Sds C A 5: 120,483,650 Q286K possibly damaging Het
Slc35a3 A T 3: 116,681,190 C184* probably null Het
Smg1 G A 7: 118,139,436 T3530I possibly damaging Het
Sspo T C 6: 48,493,280 V591A probably benign Het
Stam2 T C 2: 52,720,917 D31G probably damaging Het
Star A G 8: 25,809,917 K96E probably damaging Het
Syne3 A G 12: 104,955,672 L495P probably damaging Het
Tceanc2 A T 4: 107,165,649 M47K probably benign Het
Tecpr2 T C 12: 110,914,684 L85P probably damaging Het
Tmem241 C T 18: 12,043,263 R116K probably benign Het
Yipf2 G A 9: 21,592,191 A20V probably benign Het
Zc3h4 T A 7: 16,429,005 D443E unknown Het
Zfp184 T A 13: 21,958,577 V151D probably benign Het
Zhx1 T C 15: 58,053,299 Y517C probably damaging Het
Other mutations in Eea1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01531:Eea1 APN 10 96031677 missense probably damaging 0.99
IGL01645:Eea1 APN 10 95989589 missense probably damaging 1.00
IGL01646:Eea1 APN 10 95997015 missense probably damaging 0.99
IGL01870:Eea1 APN 10 95973986 missense probably damaging 1.00
IGL02074:Eea1 APN 10 96037487 missense probably damaging 1.00
IGL02229:Eea1 APN 10 96018184 missense probably damaging 1.00
IGL02885:Eea1 APN 10 96041484 missense probably benign 0.04
IGL02971:Eea1 APN 10 96041527 missense probably benign 0.37
IGL03223:Eea1 APN 10 96039611 missense probably damaging 1.00
IGL03355:Eea1 APN 10 96042212 utr 3 prime probably benign
prom UTSW 10 95995570 missense probably benign 0.02
R4876_eea1_897 UTSW 10 95995613 missense probably benign 0.07
Senior UTSW 10 96011037 missense probably benign
Slump UTSW 10 96036633 missense probably benign 0.00
R0189:Eea1 UTSW 10 95995582 missense possibly damaging 0.86
R0374:Eea1 UTSW 10 96039772 splice site probably benign
R0655:Eea1 UTSW 10 95995598 missense probably benign 0.00
R0883:Eea1 UTSW 10 96021667 missense possibly damaging 0.63
R1219:Eea1 UTSW 10 96010761 splice site probably benign
R1344:Eea1 UTSW 10 95994999 critical splice donor site probably null
R1768:Eea1 UTSW 10 95996960 missense probably damaging 1.00
R1887:Eea1 UTSW 10 96018211 critical splice donor site probably null
R2224:Eea1 UTSW 10 96020012 missense probably damaging 0.99
R2927:Eea1 UTSW 10 96013358 missense probably benign 0.00
R3922:Eea1 UTSW 10 96036633 missense probably benign 0.00
R3950:Eea1 UTSW 10 96042134 missense probably damaging 1.00
R4502:Eea1 UTSW 10 96039565 missense probably benign 0.14
R4647:Eea1 UTSW 10 96028393 missense probably benign
R4876:Eea1 UTSW 10 95995613 missense probably benign 0.07
R5009:Eea1 UTSW 10 96011021 missense probably benign
R5018:Eea1 UTSW 10 96011037 missense probably benign
R5588:Eea1 UTSW 10 96023910 missense probably benign 0.01
R5791:Eea1 UTSW 10 96019995 missense probably benign 0.24
R5799:Eea1 UTSW 10 96002948 missense possibly damaging 0.81
R5842:Eea1 UTSW 10 96018124 missense probably damaging 1.00
R6332:Eea1 UTSW 10 96041473 missense possibly damaging 0.79
R6376:Eea1 UTSW 10 96038798 missense probably benign 0.01
R6468:Eea1 UTSW 10 96028412 missense probably benign 0.14
R6740:Eea1 UTSW 10 96023993 missense probably benign
R6889:Eea1 UTSW 10 96037478 missense probably benign 0.14
R6904:Eea1 UTSW 10 96002879 splice site probably null
R7269:Eea1 UTSW 10 96018138 missense probably damaging 1.00
R7273:Eea1 UTSW 10 95989631 missense probably benign 0.00
R7398:Eea1 UTSW 10 95995631 missense probably benign
R7400:Eea1 UTSW 10 95995570 missense probably benign 0.02
R7537:Eea1 UTSW 10 95994905 nonsense probably null
R7687:Eea1 UTSW 10 96026598 missense probably benign
R7762:Eea1 UTSW 10 96028439 missense probably benign 0.10
R8097:Eea1 UTSW 10 96026654 missense probably benign 0.01
R8114:Eea1 UTSW 10 95994989 nonsense probably null
R8803:Eea1 UTSW 10 96023991 missense probably benign 0.13
R8853:Eea1 UTSW 10 96021655 missense
R8856:Eea1 UTSW 10 95995644 missense probably benign 0.04
R8907:Eea1 UTSW 10 95990412 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCATTTTCTCATTCAGTGGTGG -3'
(R):5'- TTCAGGTAACAAATCCTAGAGGGTC -3'

Sequencing Primer
(F):5'- CTCATTCAGTGGTGGTTTCAGAATG -3'
(R):5'- ACACTTGGTGACTCTCTAAAGTC -3'
Posted On2016-10-05