Incidental Mutation 'R5490:Asic2'
ID432049
Institutional Source Beutler Lab
Gene Symbol Asic2
Ensembl Gene ENSMUSG00000020704
Gene Nameacid-sensing (proton-gated) ion channel 2
SynonymsMdeg, BNC1, BNaC1a, Accn1
MMRRC Submission 043051-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5490 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location80880169-81968457 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 80889820 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 370 (N370S)
Ref Sequence ENSEMBL: ENSMUSP00000067095 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021045] [ENSMUST00000066197]
Predicted Effect probably benign
Transcript: ENSMUST00000021045
AA Change: N421S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000021045
Gene: ENSMUSG00000020704
AA Change: N421S

DomainStartEndE-ValueType
low complexity region 23 38 N/A INTRINSIC
Pfam:ASC 61 504 6.7e-94 PFAM
low complexity region 507 523 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000066197
AA Change: N370S

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000067095
Gene: ENSMUSG00000020704
AA Change: N370S

DomainStartEndE-ValueType
Pfam:ASC 20 454 3.3e-177 PFAM
low complexity region 456 472 N/A INTRINSIC
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.3%
  • 10x: 95.2%
  • 20x: 90.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the degenerin/epithelial sodium channel (DEG/ENaC) superfamily. The members of this family are amiloride-sensitive sodium channels that contain intracellular N and C termini, 2 hydrophobic transmembrane regions, and a large extracellular loop, which has many cysteine residues with conserved spacing. The member encoded by this gene may play a role in neurotransmission. In addition, a heteromeric association between this member and acid-sensing (proton-gated) ion channel 3 has been observed to co-assemble into proton-gated channels sensitive to gadolinium. Alternative splicing has been observed at this locus and two variants, encoding distinct isoforms, have been identified. [provided by RefSeq, Feb 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased mechanoreceptor and spiral ganglion electrophysiology and decreased pressure-induced blood vessel constriction. Mice homozygous for a different knock-out allele exhibit retinal degeneration and abnormal eye electrophysiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810013L24Rik T A 16: 8,855,857 V216E probably damaging Het
2310035C23Rik T A 1: 105,719,501 V672D probably damaging Het
4933406M09Rik A G 1: 134,389,928 D146G probably damaging Het
Aatf C T 11: 84,510,273 G174D probably damaging Het
Abcc1 G T 16: 14,410,917 G343C probably damaging Het
Btnl9 T C 11: 49,169,568 E451G probably damaging Het
Cblb A G 16: 52,174,370 H658R possibly damaging Het
Cdca2 T C 14: 67,680,284 E555G possibly damaging Het
Chfr A G 5: 110,153,129 S299G possibly damaging Het
Eea1 A G 10: 96,026,054 E741G probably benign Het
Gapvd1 T C 2: 34,693,433 D1057G probably benign Het
Glyat C T 19: 12,650,281 T80M probably benign Het
Gpr87 T C 3: 59,179,326 S253G probably damaging Het
Hmgxb3 A G 18: 61,162,977 S320P probably damaging Het
Kcnq5 C T 1: 21,479,468 G345D probably damaging Het
Kif5c T C 2: 49,758,858 V938A probably benign Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Madd G T 2: 91,170,635 T467K possibly damaging Het
Mamdc4 T C 2: 25,565,878 D706G probably damaging Het
Map2 A G 1: 66,413,133 H476R probably damaging Het
Mpeg1 T C 19: 12,461,693 S172P probably damaging Het
Nkx2-3 A T 19: 43,612,654 T52S probably benign Het
Nup210 C T 6: 91,085,988 V230I probably damaging Het
Olfr1009 G T 2: 85,722,322 A306S probably benign Het
Olfr348 T A 2: 36,787,181 Y219N probably damaging Het
Olfr568 T C 7: 102,877,893 S258P probably damaging Het
Pepd A G 7: 34,942,690 probably null Het
Ppp1r36 T A 12: 76,437,986 W238R probably damaging Het
Ppp1r36 G T 12: 76,437,987 W238L possibly damaging Het
Prpf6 T G 2: 181,608,165 D39E probably benign Het
Rassf5 T A 1: 131,181,195 Q163L possibly damaging Het
Rbm43 T A 2: 51,925,595 T205S probably benign Het
Robo4 CGG CG 9: 37,411,490 probably null Het
Sds C A 5: 120,483,650 Q286K possibly damaging Het
Slc35a3 A T 3: 116,681,190 C184* probably null Het
Smg1 G A 7: 118,139,436 T3530I possibly damaging Het
Sspo T C 6: 48,493,280 V591A probably benign Het
Stam2 T C 2: 52,720,917 D31G probably damaging Het
Star A G 8: 25,809,917 K96E probably damaging Het
Syne3 A G 12: 104,955,672 L495P probably damaging Het
Tceanc2 A T 4: 107,165,649 M47K probably benign Het
Tecpr2 T C 12: 110,914,684 L85P probably damaging Het
Tmem241 C T 18: 12,043,263 R116K probably benign Het
Yipf2 G A 9: 21,592,191 A20V probably benign Het
Zc3h4 T A 7: 16,429,005 D443E unknown Het
Zfp184 T A 13: 21,958,577 V151D probably benign Het
Zhx1 T C 15: 58,053,299 Y517C probably damaging Het
Other mutations in Asic2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01651:Asic2 APN 11 80894030 missense probably damaging 0.99
IGL02420:Asic2 APN 11 80881653 missense probably benign 0.05
IGL02451:Asic2 APN 11 80891737 splice site probably benign
LCD18:Asic2 UTSW 11 80985744 intron probably benign
R0682:Asic2 UTSW 11 80886680 missense possibly damaging 0.67
R0718:Asic2 UTSW 11 80971456 splice site probably benign
R0784:Asic2 UTSW 11 80893989 missense possibly damaging 0.92
R2679:Asic2 UTSW 11 81151954 missense probably benign 0.13
R2883:Asic2 UTSW 11 80894013 missense possibly damaging 0.61
R2991:Asic2 UTSW 11 81968037 missense probably benign
R4722:Asic2 UTSW 11 81968183 start codon destroyed probably null 0.00
R4770:Asic2 UTSW 11 80971492 missense probably benign 0.07
R4900:Asic2 UTSW 11 81573454 intron probably benign
R5005:Asic2 UTSW 11 80883426 missense probably damaging 1.00
R5056:Asic2 UTSW 11 80971603 missense possibly damaging 0.64
R5344:Asic2 UTSW 11 80971587 missense probably damaging 1.00
R5722:Asic2 UTSW 11 81967980 missense probably benign 0.07
R6072:Asic2 UTSW 11 80894088 missense probably damaging 0.97
R6589:Asic2 UTSW 11 80886604 missense possibly damaging 0.79
R7068:Asic2 UTSW 11 81152255 missense probably benign 0.01
R7226:Asic2 UTSW 11 80971514 missense probably damaging 1.00
R7593:Asic2 UTSW 11 81967831 missense probably benign 0.01
R7869:Asic2 UTSW 11 81967998 missense probably damaging 1.00
R7952:Asic2 UTSW 11 81967998 missense probably damaging 1.00
Z1176:Asic2 UTSW 11 80889832 missense possibly damaging 0.55
Z1176:Asic2 UTSW 11 81967670 missense probably benign 0.05
Z1177:Asic2 UTSW 11 80894011 missense possibly damaging 0.76
Z1177:Asic2 UTSW 11 81152090 missense probably benign 0.00
Z1177:Asic2 UTSW 11 81152240 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- AGGAGGCTGCAAGCTCTTTG -3'
(R):5'- ACCAGAGATTCTCACTGTCTACC -3'

Sequencing Primer
(F):5'- TTTTGAGCCTGGCACACAGC -3'
(R):5'- AGAGATTCTCACTGTCTACCTCCCC -3'
Posted On2016-10-05