Incidental Mutation 'R5490:Ppp1r36'
ID432051
Institutional Source Beutler Lab
Gene Symbol Ppp1r36
Ensembl Gene ENSMUSG00000052221
Gene Nameprotein phosphatase 1, regulatory subunit 36
Synonyms
MMRRC Submission 043051-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.203) question?
Stock #R5490 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location76417538-76439492 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 76437986 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 238 (W238R)
Ref Sequence ENSEMBL: ENSMUSP00000069849 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063977]
Predicted Effect probably damaging
Transcript: ENSMUST00000063977
AA Change: W238R

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000069849
Gene: ENSMUSG00000052221
AA Change: W238R

DomainStartEndE-ValueType
Pfam:PPPI_inhib 52 402 5.7e-109 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218732
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219251
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.3%
  • 10x: 95.2%
  • 20x: 90.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810013L24Rik T A 16: 8,855,857 V216E probably damaging Het
2310035C23Rik T A 1: 105,719,501 V672D probably damaging Het
4933406M09Rik A G 1: 134,389,928 D146G probably damaging Het
Aatf C T 11: 84,510,273 G174D probably damaging Het
Abcc1 G T 16: 14,410,917 G343C probably damaging Het
Asic2 T C 11: 80,889,820 N370S probably benign Het
Btnl9 T C 11: 49,169,568 E451G probably damaging Het
Cblb A G 16: 52,174,370 H658R possibly damaging Het
Cdca2 T C 14: 67,680,284 E555G possibly damaging Het
Chfr A G 5: 110,153,129 S299G possibly damaging Het
Eea1 A G 10: 96,026,054 E741G probably benign Het
Gapvd1 T C 2: 34,693,433 D1057G probably benign Het
Glyat C T 19: 12,650,281 T80M probably benign Het
Gpr87 T C 3: 59,179,326 S253G probably damaging Het
Hmgxb3 A G 18: 61,162,977 S320P probably damaging Het
Kcnq5 C T 1: 21,479,468 G345D probably damaging Het
Kif5c T C 2: 49,758,858 V938A probably benign Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Madd G T 2: 91,170,635 T467K possibly damaging Het
Mamdc4 T C 2: 25,565,878 D706G probably damaging Het
Map2 A G 1: 66,413,133 H476R probably damaging Het
Mpeg1 T C 19: 12,461,693 S172P probably damaging Het
Nkx2-3 A T 19: 43,612,654 T52S probably benign Het
Nup210 C T 6: 91,085,988 V230I probably damaging Het
Olfr1009 G T 2: 85,722,322 A306S probably benign Het
Olfr348 T A 2: 36,787,181 Y219N probably damaging Het
Olfr568 T C 7: 102,877,893 S258P probably damaging Het
Pepd A G 7: 34,942,690 probably null Het
Prpf6 T G 2: 181,608,165 D39E probably benign Het
Rassf5 T A 1: 131,181,195 Q163L possibly damaging Het
Rbm43 T A 2: 51,925,595 T205S probably benign Het
Robo4 CGG CG 9: 37,411,490 probably null Het
Sds C A 5: 120,483,650 Q286K possibly damaging Het
Slc35a3 A T 3: 116,681,190 C184* probably null Het
Smg1 G A 7: 118,139,436 T3530I possibly damaging Het
Sspo T C 6: 48,493,280 V591A probably benign Het
Stam2 T C 2: 52,720,917 D31G probably damaging Het
Star A G 8: 25,809,917 K96E probably damaging Het
Syne3 A G 12: 104,955,672 L495P probably damaging Het
Tceanc2 A T 4: 107,165,649 M47K probably benign Het
Tecpr2 T C 12: 110,914,684 L85P probably damaging Het
Tmem241 C T 18: 12,043,263 R116K probably benign Het
Yipf2 G A 9: 21,592,191 A20V probably benign Het
Zc3h4 T A 7: 16,429,005 D443E unknown Het
Zfp184 T A 13: 21,958,577 V151D probably benign Het
Zhx1 T C 15: 58,053,299 Y517C probably damaging Het
Other mutations in Ppp1r36
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01585:Ppp1r36 APN 12 76439117 critical splice acceptor site probably null
IGL01744:Ppp1r36 APN 12 76439232 missense possibly damaging 0.83
IGL03295:Ppp1r36 APN 12 76438418 missense probably damaging 0.97
R0099:Ppp1r36 UTSW 12 76436282 splice site probably null
R0332:Ppp1r36 UTSW 12 76427903 missense probably benign 0.32
R0463:Ppp1r36 UTSW 12 76418967 missense probably damaging 0.98
R0491:Ppp1r36 UTSW 12 76439291 missense probably benign 0.01
R1664:Ppp1r36 UTSW 12 76436254 missense possibly damaging 0.84
R2011:Ppp1r36 UTSW 12 76418926 critical splice acceptor site probably null
R3918:Ppp1r36 UTSW 12 76417657 missense probably benign 0.00
R5352:Ppp1r36 UTSW 12 76428083 missense probably damaging 1.00
R5464:Ppp1r36 UTSW 12 76428078 critical splice acceptor site probably null
R5490:Ppp1r36 UTSW 12 76437987 missense possibly damaging 0.85
R5523:Ppp1r36 UTSW 12 76438118 missense possibly damaging 0.71
R5844:Ppp1r36 UTSW 12 76426792 missense possibly damaging 0.71
R5849:Ppp1r36 UTSW 12 76439157 missense probably damaging 0.99
R5866:Ppp1r36 UTSW 12 76426805 missense possibly damaging 0.71
R5996:Ppp1r36 UTSW 12 76439162 missense possibly damaging 0.71
R6443:Ppp1r36 UTSW 12 76417639 missense probably benign
R6612:Ppp1r36 UTSW 12 76437604 missense possibly damaging 0.52
R6756:Ppp1r36 UTSW 12 76427922 missense probably benign 0.28
R7979:Ppp1r36 UTSW 12 76428149 splice site probably null
X0025:Ppp1r36 UTSW 12 76426810 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CACGTGTAACTCTGTGCAGC -3'
(R):5'- TCTTGAGTGGAGGAAAGGCC -3'

Sequencing Primer
(F):5'- GTAACTCTGTGCAGCTTCCGG -3'
(R):5'- CGTCATGCAGACTGTAATGC -3'
Posted On2016-10-05