Incidental Mutation 'R5490:Syne3'
ID432053
Institutional Source Beutler Lab
Gene Symbol Syne3
Ensembl Gene ENSMUSG00000054150
Gene Namespectrin repeat containing, nuclear envelope family member 3
Synonyms4831426I19Rik, nesprin-3, nesprin-3alpha, nesprin-3beta
MMRRC Submission 043051-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5490 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location104929933-105009809 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 104955672 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 495 (L495P)
Ref Sequence ENSEMBL: ENSMUSP00000093090 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067005] [ENSMUST00000095439] [ENSMUST00000109927]
Predicted Effect probably benign
Transcript: ENSMUST00000067005
AA Change: L408P

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000065771
Gene: ENSMUSG00000054150
AA Change: L408P

DomainStartEndE-ValueType
Blast:SPEC 29 127 8e-24 BLAST
SPEC 136 237 1.01e-1 SMART
Blast:SPEC 252 446 9e-55 BLAST
low complexity region 447 459 N/A INTRINSIC
low complexity region 495 514 N/A INTRINSIC
SPEC 563 664 1.74e-1 SMART
Blast:SPEC 722 818 1e-12 BLAST
KASH 832 888 7.52e-24 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000095439
AA Change: L495P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000093090
Gene: ENSMUSG00000054150
AA Change: L495P

DomainStartEndE-ValueType
SPEC 7 109 1.22e-1 SMART
SPEC 223 324 1.01e-1 SMART
Blast:SPEC 339 533 2e-54 BLAST
low complexity region 534 546 N/A INTRINSIC
low complexity region 582 601 N/A INTRINSIC
SPEC 650 751 1.74e-1 SMART
Blast:SPEC 809 905 1e-12 BLAST
KASH 919 975 7.52e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109927
AA Change: L408P

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000105553
Gene: ENSMUSG00000054150
AA Change: L408P

DomainStartEndE-ValueType
Blast:SPEC 29 127 8e-24 BLAST
SPEC 136 237 1.01e-1 SMART
Blast:SPEC 252 446 9e-55 BLAST
low complexity region 447 459 N/A INTRINSIC
low complexity region 495 514 N/A INTRINSIC
SPEC 563 664 1.74e-1 SMART
Blast:SPEC 722 818 1e-12 BLAST
KASH 832 888 7.52e-24 SMART
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.3%
  • 10x: 95.2%
  • 20x: 90.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810013L24Rik T A 16: 8,855,857 V216E probably damaging Het
2310035C23Rik T A 1: 105,719,501 V672D probably damaging Het
4933406M09Rik A G 1: 134,389,928 D146G probably damaging Het
Aatf C T 11: 84,510,273 G174D probably damaging Het
Abcc1 G T 16: 14,410,917 G343C probably damaging Het
Asic2 T C 11: 80,889,820 N370S probably benign Het
Btnl9 T C 11: 49,169,568 E451G probably damaging Het
Cblb A G 16: 52,174,370 H658R possibly damaging Het
Cdca2 T C 14: 67,680,284 E555G possibly damaging Het
Chfr A G 5: 110,153,129 S299G possibly damaging Het
Eea1 A G 10: 96,026,054 E741G probably benign Het
Gapvd1 T C 2: 34,693,433 D1057G probably benign Het
Glyat C T 19: 12,650,281 T80M probably benign Het
Gpr87 T C 3: 59,179,326 S253G probably damaging Het
Hmgxb3 A G 18: 61,162,977 S320P probably damaging Het
Kcnq5 C T 1: 21,479,468 G345D probably damaging Het
Kif5c T C 2: 49,758,858 V938A probably benign Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Madd G T 2: 91,170,635 T467K possibly damaging Het
Mamdc4 T C 2: 25,565,878 D706G probably damaging Het
Map2 A G 1: 66,413,133 H476R probably damaging Het
Mpeg1 T C 19: 12,461,693 S172P probably damaging Het
Nkx2-3 A T 19: 43,612,654 T52S probably benign Het
Nup210 C T 6: 91,085,988 V230I probably damaging Het
Olfr1009 G T 2: 85,722,322 A306S probably benign Het
Olfr348 T A 2: 36,787,181 Y219N probably damaging Het
Olfr568 T C 7: 102,877,893 S258P probably damaging Het
Pepd A G 7: 34,942,690 probably null Het
Ppp1r36 T A 12: 76,437,986 W238R probably damaging Het
Ppp1r36 G T 12: 76,437,987 W238L possibly damaging Het
Prpf6 T G 2: 181,608,165 D39E probably benign Het
Rassf5 T A 1: 131,181,195 Q163L possibly damaging Het
Rbm43 T A 2: 51,925,595 T205S probably benign Het
Robo4 CGG CG 9: 37,411,490 probably null Het
Sds C A 5: 120,483,650 Q286K possibly damaging Het
Slc35a3 A T 3: 116,681,190 C184* probably null Het
Smg1 G A 7: 118,139,436 T3530I possibly damaging Het
Sspo T C 6: 48,493,280 V591A probably benign Het
Stam2 T C 2: 52,720,917 D31G probably damaging Het
Star A G 8: 25,809,917 K96E probably damaging Het
Tceanc2 A T 4: 107,165,649 M47K probably benign Het
Tecpr2 T C 12: 110,914,684 L85P probably damaging Het
Tmem241 C T 18: 12,043,263 R116K probably benign Het
Yipf2 G A 9: 21,592,191 A20V probably benign Het
Zc3h4 T A 7: 16,429,005 D443E unknown Het
Zfp184 T A 13: 21,958,577 V151D probably benign Het
Zhx1 T C 15: 58,053,299 Y517C probably damaging Het
Other mutations in Syne3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01154:Syne3 APN 12 104958069 missense probably benign 0.00
IGL01986:Syne3 APN 12 104968000 missense probably damaging 1.00
IGL02303:Syne3 APN 12 104963294 missense probably damaging 1.00
IGL02469:Syne3 APN 12 104954306 missense probably benign 0.08
IGL03127:Syne3 APN 12 104943428 missense probably benign 0.02
BB008:Syne3 UTSW 12 104963232 missense probably damaging 0.97
BB018:Syne3 UTSW 12 104963232 missense probably damaging 0.97
PIT4791001:Syne3 UTSW 12 104963179 missense probably benign
R0436:Syne3 UTSW 12 104946924 missense possibly damaging 0.95
R0471:Syne3 UTSW 12 104943426 missense probably benign 0.00
R0613:Syne3 UTSW 12 104958112 missense probably benign
R0662:Syne3 UTSW 12 104961510 missense probably benign 0.44
R0707:Syne3 UTSW 12 104969360 missense probably damaging 0.98
R1321:Syne3 UTSW 12 104975796 missense probably benign 0.14
R1494:Syne3 UTSW 12 104955582 missense possibly damaging 0.87
R2035:Syne3 UTSW 12 104958127 missense probably benign 0.00
R2147:Syne3 UTSW 12 104953098 missense probably damaging 1.00
R2326:Syne3 UTSW 12 104969234 missense probably damaging 1.00
R2923:Syne3 UTSW 12 104968084 missense probably damaging 1.00
R3710:Syne3 UTSW 12 104943438 missense possibly damaging 0.86
R3946:Syne3 UTSW 12 104958066 missense probably damaging 1.00
R4542:Syne3 UTSW 12 104969244 missense probably benign 0.00
R4544:Syne3 UTSW 12 104959469 missense probably damaging 1.00
R5110:Syne3 UTSW 12 104943370 missense probably benign 0.10
R5256:Syne3 UTSW 12 104975880 start codon destroyed probably null 1.00
R5616:Syne3 UTSW 12 104955678 missense probably damaging 1.00
R5730:Syne3 UTSW 12 104961454 missense probably benign 0.02
R5941:Syne3 UTSW 12 104946992 missense probably benign
R6208:Syne3 UTSW 12 104943363 missense probably benign 0.12
R6456:Syne3 UTSW 12 104940704 missense possibly damaging 0.87
R6566:Syne3 UTSW 12 104946707 missense probably benign 0.00
R6957:Syne3 UTSW 12 104954302 missense probably damaging 1.00
R7251:Syne3 UTSW 12 104961571 frame shift probably null
R7388:Syne3 UTSW 12 104967908 missense probably damaging 1.00
R7591:Syne3 UTSW 12 104940604 critical splice donor site probably null
R7614:Syne3 UTSW 12 104946642 missense not run
R7740:Syne3 UTSW 12 104954287 missense probably benign 0.01
R7763:Syne3 UTSW 12 104997495 start gained probably benign
R7931:Syne3 UTSW 12 104963232 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- ACATAGGCGCACATCCAGAG -3'
(R):5'- TGTAAAATTCAGGGCCTCCC -3'

Sequencing Primer
(F):5'- ACATCCAGAGCCATGGGG -3'
(R):5'- CAACCCACTTCTGCAAGTCTG -3'
Posted On2016-10-05