Incidental Mutation 'R5490:Zfp184'
ID432055
Institutional Source Beutler Lab
Gene Symbol Zfp184
Ensembl Gene ENSMUSG00000006720
Gene Namezinc finger protein 184 (Kruppel-like)
Synonyms
MMRRC Submission 043051-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.150) question?
Stock #R5490 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location21945094-21960779 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 21958577 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 151 (V151D)
Ref Sequence ENSEMBL: ENSMUSP00000135173 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006903] [ENSMUST00000102978] [ENSMUST00000176511] [ENSMUST00000176580]
Predicted Effect probably benign
Transcript: ENSMUST00000006903
AA Change: V151D

PolyPhen 2 Score 0.403 (Sensitivity: 0.89; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000006903
Gene: ENSMUSG00000006720
AA Change: V151D

DomainStartEndE-ValueType
KRAB 28 88 1.14e-36 SMART
ZnF_C2H2 201 223 5.42e-2 SMART
ZnF_C2H2 229 251 1.22e-4 SMART
ZnF_C2H2 257 279 2.09e-3 SMART
ZnF_C2H2 285 307 5.29e-5 SMART
ZnF_C2H2 313 335 8.6e-5 SMART
ZnF_C2H2 341 363 1.28e-3 SMART
ZnF_C2H2 369 391 1.12e-3 SMART
ZnF_C2H2 397 419 1.84e-4 SMART
ZnF_C2H2 425 447 2.4e-3 SMART
ZnF_C2H2 453 475 4.79e-3 SMART
ZnF_C2H2 481 503 3.69e-4 SMART
ZnF_C2H2 509 531 7.37e-4 SMART
ZnF_C2H2 537 559 6.88e-4 SMART
ZnF_C2H2 565 587 2.43e-4 SMART
ZnF_C2H2 593 615 2.75e-3 SMART
ZnF_C2H2 621 643 5.99e-4 SMART
ZnF_C2H2 649 671 8.94e-3 SMART
ZnF_C2H2 679 698 4.27e1 SMART
ZnF_C2H2 704 726 1.23e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000102978
AA Change: V151D

PolyPhen 2 Score 0.403 (Sensitivity: 0.89; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000100043
Gene: ENSMUSG00000006720
AA Change: V151D

DomainStartEndE-ValueType
KRAB 28 88 1.14e-36 SMART
ZnF_C2H2 201 223 5.42e-2 SMART
ZnF_C2H2 229 251 1.22e-4 SMART
ZnF_C2H2 257 279 2.09e-3 SMART
ZnF_C2H2 285 307 5.29e-5 SMART
ZnF_C2H2 313 335 8.6e-5 SMART
ZnF_C2H2 341 363 1.28e-3 SMART
ZnF_C2H2 369 391 1.12e-3 SMART
ZnF_C2H2 397 419 1.84e-4 SMART
ZnF_C2H2 425 447 2.4e-3 SMART
ZnF_C2H2 453 475 4.79e-3 SMART
ZnF_C2H2 481 503 3.69e-4 SMART
ZnF_C2H2 509 531 7.37e-4 SMART
ZnF_C2H2 537 559 6.88e-4 SMART
ZnF_C2H2 565 587 2.43e-4 SMART
ZnF_C2H2 593 615 2.75e-3 SMART
ZnF_C2H2 621 643 5.99e-4 SMART
ZnF_C2H2 649 671 8.94e-3 SMART
ZnF_C2H2 679 698 4.27e1 SMART
ZnF_C2H2 704 726 1.23e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000119018
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141391
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176003
Predicted Effect probably benign
Transcript: ENSMUST00000176511
AA Change: V151D

PolyPhen 2 Score 0.403 (Sensitivity: 0.89; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000135173
Gene: ENSMUSG00000006720
AA Change: V151D

DomainStartEndE-ValueType
KRAB 28 88 1.14e-36 SMART
ZnF_C2H2 201 223 5.42e-2 SMART
ZnF_C2H2 229 251 1.22e-4 SMART
ZnF_C2H2 257 279 2.09e-3 SMART
ZnF_C2H2 285 307 5.29e-5 SMART
ZnF_C2H2 313 335 8.6e-5 SMART
ZnF_C2H2 341 363 1.28e-3 SMART
ZnF_C2H2 369 391 1.12e-3 SMART
ZnF_C2H2 397 419 1.84e-4 SMART
ZnF_C2H2 425 447 2.4e-3 SMART
ZnF_C2H2 453 475 4.79e-3 SMART
ZnF_C2H2 481 503 3.69e-4 SMART
ZnF_C2H2 509 531 7.37e-4 SMART
ZnF_C2H2 537 559 6.88e-4 SMART
ZnF_C2H2 565 587 2.43e-4 SMART
ZnF_C2H2 593 615 2.75e-3 SMART
ZnF_C2H2 621 643 5.99e-4 SMART
ZnF_C2H2 649 671 8.94e-3 SMART
ZnF_C2H2 679 698 4.27e1 SMART
ZnF_C2H2 704 726 1.23e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000176580
SMART Domains Protein: ENSMUSP00000135404
Gene: ENSMUSG00000006720

DomainStartEndE-ValueType
KRAB 28 84 1.96e-17 SMART
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.3%
  • 10x: 95.2%
  • 20x: 90.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is predicted to be a Kruppel C2H2-type zinc-finger protein family member. Sequence analysis predicts that the protein contains two Kruppel associated box (KRAB) boxes in the N-terminus and highly conserved zinc finger motifs at the C-terminus. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2016]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810013L24Rik T A 16: 8,855,857 V216E probably damaging Het
2310035C23Rik T A 1: 105,719,501 V672D probably damaging Het
4933406M09Rik A G 1: 134,389,928 D146G probably damaging Het
Aatf C T 11: 84,510,273 G174D probably damaging Het
Abcc1 G T 16: 14,410,917 G343C probably damaging Het
Asic2 T C 11: 80,889,820 N370S probably benign Het
Btnl9 T C 11: 49,169,568 E451G probably damaging Het
Cblb A G 16: 52,174,370 H658R possibly damaging Het
Cdca2 T C 14: 67,680,284 E555G possibly damaging Het
Chfr A G 5: 110,153,129 S299G possibly damaging Het
Eea1 A G 10: 96,026,054 E741G probably benign Het
Gapvd1 T C 2: 34,693,433 D1057G probably benign Het
Glyat C T 19: 12,650,281 T80M probably benign Het
Gpr87 T C 3: 59,179,326 S253G probably damaging Het
Hmgxb3 A G 18: 61,162,977 S320P probably damaging Het
Kcnq5 C T 1: 21,479,468 G345D probably damaging Het
Kif5c T C 2: 49,758,858 V938A probably benign Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Madd G T 2: 91,170,635 T467K possibly damaging Het
Mamdc4 T C 2: 25,565,878 D706G probably damaging Het
Map2 A G 1: 66,413,133 H476R probably damaging Het
Mpeg1 T C 19: 12,461,693 S172P probably damaging Het
Nkx2-3 A T 19: 43,612,654 T52S probably benign Het
Nup210 C T 6: 91,085,988 V230I probably damaging Het
Olfr1009 G T 2: 85,722,322 A306S probably benign Het
Olfr348 T A 2: 36,787,181 Y219N probably damaging Het
Olfr568 T C 7: 102,877,893 S258P probably damaging Het
Pepd A G 7: 34,942,690 probably null Het
Ppp1r36 T A 12: 76,437,986 W238R probably damaging Het
Ppp1r36 G T 12: 76,437,987 W238L possibly damaging Het
Prpf6 T G 2: 181,608,165 D39E probably benign Het
Rassf5 T A 1: 131,181,195 Q163L possibly damaging Het
Rbm43 T A 2: 51,925,595 T205S probably benign Het
Robo4 CGG CG 9: 37,411,490 probably null Het
Sds C A 5: 120,483,650 Q286K possibly damaging Het
Slc35a3 A T 3: 116,681,190 C184* probably null Het
Smg1 G A 7: 118,139,436 T3530I possibly damaging Het
Sspo T C 6: 48,493,280 V591A probably benign Het
Stam2 T C 2: 52,720,917 D31G probably damaging Het
Star A G 8: 25,809,917 K96E probably damaging Het
Syne3 A G 12: 104,955,672 L495P probably damaging Het
Tceanc2 A T 4: 107,165,649 M47K probably benign Het
Tecpr2 T C 12: 110,914,684 L85P probably damaging Het
Tmem241 C T 18: 12,043,263 R116K probably benign Het
Yipf2 G A 9: 21,592,191 A20V probably benign Het
Zc3h4 T A 7: 16,429,005 D443E unknown Het
Zhx1 T C 15: 58,053,299 Y517C probably damaging Het
Other mutations in Zfp184
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01674:Zfp184 APN 13 21950225 splice site probably benign
R0393:Zfp184 UTSW 13 21947082 splice site probably benign
R0636:Zfp184 UTSW 13 21949749 missense probably damaging 1.00
R1657:Zfp184 UTSW 13 21959273 missense probably damaging 1.00
R1718:Zfp184 UTSW 13 21959272 missense possibly damaging 0.76
R4237:Zfp184 UTSW 13 21958778 missense probably damaging 1.00
R4326:Zfp184 UTSW 13 21959902 missense probably damaging 1.00
R4327:Zfp184 UTSW 13 21959902 missense probably damaging 1.00
R4328:Zfp184 UTSW 13 21959902 missense probably damaging 1.00
R4877:Zfp184 UTSW 13 21960328 missense possibly damaging 0.92
R4941:Zfp184 UTSW 13 21949721 missense probably damaging 1.00
R5014:Zfp184 UTSW 13 21958424 missense probably benign 0.37
R5054:Zfp184 UTSW 13 21959282 missense possibly damaging 0.74
R5105:Zfp184 UTSW 13 21959629 missense possibly damaging 0.58
R5216:Zfp184 UTSW 13 21950236 missense probably damaging 1.00
R5379:Zfp184 UTSW 13 21959881 missense probably damaging 1.00
R5387:Zfp184 UTSW 13 21949640 intron probably benign
R6220:Zfp184 UTSW 13 21960207 missense probably damaging 1.00
R6752:Zfp184 UTSW 13 21959408 missense probably damaging 0.99
R7088:Zfp184 UTSW 13 21959992 missense probably damaging 1.00
R7653:Zfp184 UTSW 13 21959717 missense probably damaging 1.00
R7980:Zfp184 UTSW 13 21960206 missense probably damaging 1.00
R8056:Zfp184 UTSW 13 21958838 missense probably damaging 1.00
R8214:Zfp184 UTSW 13 21958825 missense probably damaging 1.00
R8235:Zfp184 UTSW 13 21959883 missense probably damaging 1.00
R8748:Zfp184 UTSW 13 21960047 missense probably benign 0.00
X0057:Zfp184 UTSW 13 21959548 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATAGATAATCTCCAACAAGGGCAG -3'
(R):5'- AAAGCTTTACCACATTCGTTGC -3'

Sequencing Primer
(F):5'- ATCTCCAACAAGGGCAGTTTTC -3'
(R):5'- ACATTCGTTGCACTTACACAG -3'
Posted On2016-10-05