Mutagenetix > Incidental Mutation

Incidental Mutation 'R5490:Cblb'

432062

Institutional Source

Beutler Lab

Gene Symbol

Cblb

Ensembl Gene

ENSMUSG00000022637

Gene Name

Casitas B-lineage lymphoma b

Synonyms

Cbl-b

MMRRC Submission

043051-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.261) question?

Stock #

R5490 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

52031225-52208048 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 52174370 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Arginine at position 658 (H658R)

Ref Sequence

ENSEMBL: ENSMUSP00000154583 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000114471] [ENSMUST00000226593] [ENSMUST00000227062] [ENSMUST00000227756] [ENSMUST00000227879]

AlphaFold

Q3TTA7

Predicted Effect

possibly damaging
Transcript: ENSMUST00000114471
AA Change: H658R

PolyPhen 2 Score 0.524 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000110115
Gene: ENSMUSG00000022637
AA Change: H658R

Domain	Start	End	E-Value	Type
low complexity region	6	21	N/A	INTRINSIC
Pfam:Cbl_N	41	167	1.5e-58	PFAM
Pfam:Cbl_N2	171	254	2.9e-43	PFAM
SH2	257	354	3.22e0	SMART
RING	373	411	1.04e-7	SMART
low complexity region	447	454	N/A	INTRINSIC
low complexity region	543	567	N/A	INTRINSIC
low complexity region	666	682	N/A	INTRINSIC
low complexity region	773	783	N/A	INTRINSIC
low complexity region	792	804	N/A	INTRINSIC
low complexity region	857	871	N/A	INTRINSIC
UBA	888	925	4.06e-6	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000226593
AA Change: H658R

PolyPhen 2 Score 0.055 (Sensitivity: 0.94; Specificity: 0.84)

Predicted Effect

possibly damaging
Transcript: ENSMUST00000227062
AA Change: H658R

PolyPhen 2 Score 0.524 (Sensitivity: 0.88; Specificity: 0.90)

Predicted Effect

probably benign
Transcript: ENSMUST00000227756
AA Change: H506R

PolyPhen 2 Score 0.055 (Sensitivity: 0.94; Specificity: 0.84)

Predicted Effect

probably benign
Transcript: ENSMUST00000227879
AA Change: H658R

PolyPhen 2 Score 0.055 (Sensitivity: 0.94; Specificity: 0.84)

Coding Region Coverage

1x: 98.3%
3x: 97.3%
10x: 95.2%
20x: 90.8%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Homozygotes for targeted null mutations exhibit elevated IL2 production by T cells, develop spontaneous autoimmunity, and are highly susceptible to experimental autoimmune encephalomyelitis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 47 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1810013L24Rik	T	A	16: 8,855,857	V216E	probably damaging	Het
2310035C23Rik	T	A	1: 105,719,501	V672D	probably damaging	Het
4933406M09Rik	A	G	1: 134,389,928	D146G	probably damaging	Het
Aatf	C	T	11: 84,510,273	G174D	probably damaging	Het
Abcc1	G	T	16: 14,410,917	G343C	probably damaging	Het
Asic2	T	C	11: 80,889,820	N370S	probably benign	Het
Btnl9	T	C	11: 49,169,568	E451G	probably damaging	Het
Cdca2	T	C	14: 67,680,284	E555G	possibly damaging	Het
Chfr	A	G	5: 110,153,129	S299G	possibly damaging	Het
Eea1	A	G	10: 96,026,054	E741G	probably benign	Het
Gapvd1	T	C	2: 34,693,433	D1057G	probably benign	Het
Glyat	C	T	19: 12,650,281	T80M	probably benign	Het
Gpr87	T	C	3: 59,179,326	S253G	probably damaging	Het
Hmgxb3	A	G	18: 61,162,977	S320P	probably damaging	Het
Kcnq5	C	T	1: 21,479,468	G345D	probably damaging	Het
Kif5c	T	C	2: 49,758,858	V938A	probably benign	Het
Klk14	G	A	7: 43,692,077	C51Y	probably damaging	Het
Madd	G	T	2: 91,170,635	T467K	possibly damaging	Het
Mamdc4	T	C	2: 25,565,878	D706G	probably damaging	Het
Map2	A	G	1: 66,413,133	H476R	probably damaging	Het
Mpeg1	T	C	19: 12,461,693	S172P	probably damaging	Het
Nkx2-3	A	T	19: 43,612,654	T52S	probably benign	Het
Nup210	C	T	6: 91,085,988	V230I	probably damaging	Het
Olfr1009	G	T	2: 85,722,322	A306S	probably benign	Het
Olfr348	T	A	2: 36,787,181	Y219N	probably damaging	Het
Olfr568	T	C	7: 102,877,893	S258P	probably damaging	Het
Pepd	A	G	7: 34,942,690		probably null	Het
Ppp1r36	T	A	12: 76,437,986	W238R	probably damaging	Het
Ppp1r36	G	T	12: 76,437,987	W238L	possibly damaging	Het
Prpf6	T	G	2: 181,608,165	D39E	probably benign	Het
Rassf5	T	A	1: 131,181,195	Q163L	possibly damaging	Het
Rbm43	T	A	2: 51,925,595	T205S	probably benign	Het
Robo4	CGG	CG	9: 37,411,490		probably null	Het
Sds	C	A	5: 120,483,650	Q286K	possibly damaging	Het
Slc35a3	A	T	3: 116,681,190	C184*	probably null	Het
Smg1	G	A	7: 118,139,436	T3530I	possibly damaging	Het
Sspo	T	C	6: 48,493,280	V591A	probably benign	Het
Stam2	T	C	2: 52,720,917	D31G	probably damaging	Het
Star	A	G	8: 25,809,917	K96E	probably damaging	Het
Syne3	A	G	12: 104,955,672	L495P	probably damaging	Het
Tceanc2	A	T	4: 107,165,649	M47K	probably benign	Het
Tecpr2	T	C	12: 110,914,684	L85P	probably damaging	Het
Tmem241	C	T	18: 12,043,263	R116K	probably benign	Het
Yipf2	G	A	9: 21,592,191	A20V	probably benign	Het
Zc3h4	T	A	7: 16,429,005	D443E	unknown	Het
Zfp184	T	A	13: 21,958,577	V151D	probably benign	Het
Zhx1	T	C	15: 58,053,299	Y517C	probably damaging	Het

Other mutations in Cblb

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00157:Cblb	APN	16	52183307	missense	probably benign	0.28
IGL00927:Cblb	APN	16	52166098	missense	probably benign
IGL01108:Cblb	APN	16	52047451	critical splice donor site	probably null
IGL01336:Cblb	APN	16	52186229	missense	probably benign	0.00
IGL01943:Cblb	APN	16	52139633	splice site	probably null
IGL02273:Cblb	APN	16	52047294	missense	possibly damaging	0.95
IGL02405:Cblb	APN	16	52166253	missense	probably benign	0.32
IGL02445:Cblb	APN	16	52166305	missense	probably damaging	1.00
IGL02728:Cblb	APN	16	52183309	missense	probably benign	0.04
IGL03000:Cblb	APN	16	52204542	missense	probably damaging	1.00
PIT4362001:Cblb	UTSW	16	52139542	nonsense	probably null
R0053:Cblb	UTSW	16	52142801	missense	probably damaging	0.97
R0053:Cblb	UTSW	16	52142801	missense	probably damaging	0.97
R0294:Cblb	UTSW	16	52135824	missense	probably damaging	1.00
R0403:Cblb	UTSW	16	52152626	missense	probably benign	0.23
R0506:Cblb	UTSW	16	52204480	missense	probably benign	0.25
R1172:Cblb	UTSW	16	52186240	splice site	probably benign
R1245:Cblb	UTSW	16	52047187	splice site	probably benign
R1443:Cblb	UTSW	16	52139611	missense	possibly damaging	0.95
R1549:Cblb	UTSW	16	52033010	splice site	probably benign
R1568:Cblb	UTSW	16	52135829	missense	probably damaging	1.00
R1734:Cblb	UTSW	16	52186240	splice site	probably benign
R2107:Cblb	UTSW	16	52152716	critical splice donor site	probably null
R2231:Cblb	UTSW	16	52194272	missense	probably benign	0.00
R4419:Cblb	UTSW	16	52047258	missense	possibly damaging	0.80
R4913:Cblb	UTSW	16	52166029	missense	possibly damaging	0.78
R4940:Cblb	UTSW	16	52033103	missense	probably damaging	1.00
R5159:Cblb	UTSW	16	52112120	missense	probably damaging	0.97
R5318:Cblb	UTSW	16	52186198	missense	possibly damaging	0.88
R5367:Cblb	UTSW	16	52204653	missense	probably damaging	1.00
R5432:Cblb	UTSW	16	52142865	missense	probably damaging	1.00
R5618:Cblb	UTSW	16	52152668	missense	possibly damaging	0.89
R6047:Cblb	UTSW	16	52112248	critical splice donor site	probably null
R6152:Cblb	UTSW	16	52141056	missense	probably damaging	0.98
R6667:Cblb	UTSW	16	52152644	missense	possibly damaging	0.81
R6914:Cblb	UTSW	16	52047430	missense	probably damaging	1.00
R7681:Cblb	UTSW	16	52204638	missense	probably damaging	0.96
R7940:Cblb	UTSW	16	52152536	missense	probably damaging	1.00
R8167:Cblb	UTSW	16	52166002	missense	probably benign	0.13
R8236:Cblb	UTSW	16	52166029	missense	possibly damaging	0.85
R8494:Cblb	UTSW	16	52204640	missense	probably damaging	1.00
R8880:Cblb	UTSW	16	52166005	missense	probably benign
R9308:Cblb	UTSW	16	52189011	critical splice acceptor site	probably null
R9386:Cblb	UTSW	16	52166338	nonsense	probably null
R9387:Cblb	UTSW	16	52033152	missense	probably benign	0.12
R9500:Cblb	UTSW	16	52139630	critical splice donor site	probably null
R9741:Cblb	UTSW	16	52112127	missense	probably damaging	1.00
X0011:Cblb	UTSW	16	52152629	missense	probably benign	0.03

Predicted Primers

PCR Primer
(F):5'- ACTGATCCTGCTGACTCCTG -3'
(R):5'- AGCAGAAGTCTTACCATCTGATAC -3'

Sequencing Primer
(F):5'- CCTGCTGACTCCTGAATAAATTG -3'
(R):5'- GTCTTACCATCTGATACTTGAAGTC -3'

Posted On

2016-10-05