Incidental Mutation 'R5490:Hmgxb3'
ID432064
Institutional Source Beutler Lab
Gene Symbol Hmgxb3
Ensembl Gene ENSMUSG00000024622
Gene NameHMG box domain containing 3
Synonyms2510002C16Rik, A630042L21Rik
MMRRC Submission 043051-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.741) question?
Stock #R5490 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location61131279-61177050 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 61162977 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 320 (S320P)
Ref Sequence ENSEMBL: ENSMUSP00000089498 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091884]
Predicted Effect probably damaging
Transcript: ENSMUST00000091884
AA Change: S320P

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000089498
Gene: ENSMUSG00000024622
AA Change: S320P

DomainStartEndE-ValueType
HMG 40 110 6.8e-15 SMART
low complexity region 182 194 N/A INTRINSIC
internal_repeat_1 307 336 1.98e-9 PROSPERO
internal_repeat_1 583 612 1.98e-9 PROSPERO
low complexity region 817 830 N/A INTRINSIC
low complexity region 966 977 N/A INTRINSIC
low complexity region 1239 1254 N/A INTRINSIC
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.3%
  • 10x: 95.2%
  • 20x: 90.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is one of the non-canonical high mobility group (HMG) genes. The encoded protein contains an HMG-box domain found in DNA binding proteins such as transcription factors and chromosomal proteins. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810013L24Rik T A 16: 8,855,857 V216E probably damaging Het
2310035C23Rik T A 1: 105,719,501 V672D probably damaging Het
4933406M09Rik A G 1: 134,389,928 D146G probably damaging Het
Aatf C T 11: 84,510,273 G174D probably damaging Het
Abcc1 G T 16: 14,410,917 G343C probably damaging Het
Asic2 T C 11: 80,889,820 N370S probably benign Het
Btnl9 T C 11: 49,169,568 E451G probably damaging Het
Cblb A G 16: 52,174,370 H658R possibly damaging Het
Cdca2 T C 14: 67,680,284 E555G possibly damaging Het
Chfr A G 5: 110,153,129 S299G possibly damaging Het
Eea1 A G 10: 96,026,054 E741G probably benign Het
Gapvd1 T C 2: 34,693,433 D1057G probably benign Het
Glyat C T 19: 12,650,281 T80M probably benign Het
Gpr87 T C 3: 59,179,326 S253G probably damaging Het
Kcnq5 C T 1: 21,479,468 G345D probably damaging Het
Kif5c T C 2: 49,758,858 V938A probably benign Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Madd G T 2: 91,170,635 T467K possibly damaging Het
Mamdc4 T C 2: 25,565,878 D706G probably damaging Het
Map2 A G 1: 66,413,133 H476R probably damaging Het
Mpeg1 T C 19: 12,461,693 S172P probably damaging Het
Nkx2-3 A T 19: 43,612,654 T52S probably benign Het
Nup210 C T 6: 91,085,988 V230I probably damaging Het
Olfr1009 G T 2: 85,722,322 A306S probably benign Het
Olfr348 T A 2: 36,787,181 Y219N probably damaging Het
Olfr568 T C 7: 102,877,893 S258P probably damaging Het
Pepd A G 7: 34,942,690 probably null Het
Ppp1r36 T A 12: 76,437,986 W238R probably damaging Het
Ppp1r36 G T 12: 76,437,987 W238L possibly damaging Het
Prpf6 T G 2: 181,608,165 D39E probably benign Het
Rassf5 T A 1: 131,181,195 Q163L possibly damaging Het
Rbm43 T A 2: 51,925,595 T205S probably benign Het
Robo4 CGG CG 9: 37,411,490 probably null Het
Sds C A 5: 120,483,650 Q286K possibly damaging Het
Slc35a3 A T 3: 116,681,190 C184* probably null Het
Smg1 G A 7: 118,139,436 T3530I possibly damaging Het
Sspo T C 6: 48,493,280 V591A probably benign Het
Stam2 T C 2: 52,720,917 D31G probably damaging Het
Star A G 8: 25,809,917 K96E probably damaging Het
Syne3 A G 12: 104,955,672 L495P probably damaging Het
Tceanc2 A T 4: 107,165,649 M47K probably benign Het
Tecpr2 T C 12: 110,914,684 L85P probably damaging Het
Tmem241 C T 18: 12,043,263 R116K probably benign Het
Yipf2 G A 9: 21,592,191 A20V probably benign Het
Zc3h4 T A 7: 16,429,005 D443E unknown Het
Zfp184 T A 13: 21,958,577 V151D probably benign Het
Zhx1 T C 15: 58,053,299 Y517C probably damaging Het
Other mutations in Hmgxb3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00594:Hmgxb3 APN 18 61157739 missense probably benign 0.00
IGL01325:Hmgxb3 APN 18 61134006 missense probably damaging 1.00
IGL01364:Hmgxb3 APN 18 61146434 missense probably damaging 0.96
IGL02160:Hmgxb3 APN 18 61171236 missense probably damaging 1.00
IGL02271:Hmgxb3 APN 18 61132213 missense probably damaging 1.00
IGL02755:Hmgxb3 APN 18 61172188 missense probably damaging 1.00
R0309:Hmgxb3 UTSW 18 61155128 splice site probably benign
R0828:Hmgxb3 UTSW 18 61171354 missense probably damaging 1.00
R1276:Hmgxb3 UTSW 18 61165504 missense probably benign 0.04
R1429:Hmgxb3 UTSW 18 61150433 missense probably damaging 0.98
R1491:Hmgxb3 UTSW 18 61133908 missense probably benign 0.04
R1675:Hmgxb3 UTSW 18 61135559 missense probably damaging 1.00
R1886:Hmgxb3 UTSW 18 61137401 critical splice donor site probably null
R1887:Hmgxb3 UTSW 18 61137401 critical splice donor site probably null
R2070:Hmgxb3 UTSW 18 61171359 missense probably damaging 1.00
R2084:Hmgxb3 UTSW 18 61155023 splice site probably benign
R2110:Hmgxb3 UTSW 18 61155386 missense possibly damaging 0.54
R2112:Hmgxb3 UTSW 18 61155386 missense possibly damaging 0.54
R2149:Hmgxb3 UTSW 18 61157674 missense probably benign 0.08
R2342:Hmgxb3 UTSW 18 61162991 missense possibly damaging 0.89
R2436:Hmgxb3 UTSW 18 61147494 missense probably benign
R2898:Hmgxb3 UTSW 18 61155296 missense probably benign 0.00
R2975:Hmgxb3 UTSW 18 61162966 nonsense probably null
R3110:Hmgxb3 UTSW 18 61147382 missense probably damaging 1.00
R3111:Hmgxb3 UTSW 18 61147382 missense probably damaging 1.00
R3112:Hmgxb3 UTSW 18 61147382 missense probably damaging 1.00
R4327:Hmgxb3 UTSW 18 61167539 missense probably benign 0.11
R4710:Hmgxb3 UTSW 18 61137475 missense probably damaging 1.00
R4750:Hmgxb3 UTSW 18 61167496 missense probably benign
R4876:Hmgxb3 UTSW 18 61146534 missense possibly damaging 0.94
R5177:Hmgxb3 UTSW 18 61172194 missense probably damaging 1.00
R5601:Hmgxb3 UTSW 18 61137622 missense probably damaging 1.00
R5718:Hmgxb3 UTSW 18 61140837 missense probably benign 0.05
R6011:Hmgxb3 UTSW 18 61163024 missense probably damaging 0.97
R6034:Hmgxb3 UTSW 18 61132522 missense probably damaging 1.00
R6034:Hmgxb3 UTSW 18 61132522 missense probably damaging 1.00
R6092:Hmgxb3 UTSW 18 61137600 missense possibly damaging 0.56
R6142:Hmgxb3 UTSW 18 61136237 missense probably benign 0.00
R6419:Hmgxb3 UTSW 18 61152224 missense possibly damaging 0.71
R6675:Hmgxb3 UTSW 18 61137576 missense possibly damaging 0.86
R7130:Hmgxb3 UTSW 18 61132378 missense probably benign
R7431:Hmgxb3 UTSW 18 61147445 missense probably damaging 1.00
R8265:Hmgxb3 UTSW 18 61167338 missense possibly damaging 0.77
R8559:Hmgxb3 UTSW 18 61155419 missense probably benign 0.19
R8674:Hmgxb3 UTSW 18 61136231 missense probably benign 0.37
R8711:Hmgxb3 UTSW 18 61157649 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGCATCACAGACACGTTCAAG -3'
(R):5'- ATTGAGCGAGATTCTGATACAGCG -3'

Sequencing Primer
(F):5'- CGTTCAAGGTTTAAAACAAGCCAG -3'
(R):5'- AGCACTATGGGCTGCCATATTCAG -3'
Posted On2016-10-05