Incidental Mutation 'R5490:Nkx2-3'
ID432067
Institutional Source Beutler Lab
Gene Symbol Nkx2-3
Ensembl Gene ENSMUSG00000044220
Gene NameNK2 homeobox 3
Synonymstinman, Nkx2.3, Nkx-2.3
MMRRC Submission 043051-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.590) question?
Stock #R5490 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location43612325-43615892 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 43612654 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 52 (T52S)
Ref Sequence ENSEMBL: ENSMUSP00000050933 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057178]
Predicted Effect probably benign
Transcript: ENSMUST00000057178
AA Change: T52S

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000050933
Gene: ENSMUSG00000044220
AA Change: T52S

DomainStartEndE-ValueType
low complexity region 58 67 N/A INTRINSIC
low complexity region 104 117 N/A INTRINSIC
HOX 145 207 2.39e-24 SMART
low complexity region 215 227 N/A INTRINSIC
low complexity region 294 310 N/A INTRINSIC
low complexity region 330 337 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172872
Coding Region Coverage
  • 1x: 98.3%
  • 3x: 97.3%
  • 10x: 95.2%
  • 20x: 90.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a homeodomain-containing transcription factor. The encoded protein is a member of the NKX family of homeodomain transcription factors. Studies of similar proteins in mouse and rat have indicated a potential role in cellular differentiation.[provided by RefSeq, Mar 2010]
PHENOTYPE: Homozygotes exhibit postnatal lethality due to acute intestinal malabsorption. Survivors recover well but exhibit splenic and Peyer's patch hypoplasia, intestinal villus malformation, gut truncation and distension, abnormal molar and sublingual gland development, and deranged lymphocyte homing. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810013L24Rik T A 16: 8,855,857 V216E probably damaging Het
2310035C23Rik T A 1: 105,719,501 V672D probably damaging Het
4933406M09Rik A G 1: 134,389,928 D146G probably damaging Het
Aatf C T 11: 84,510,273 G174D probably damaging Het
Abcc1 G T 16: 14,410,917 G343C probably damaging Het
Asic2 T C 11: 80,889,820 N370S probably benign Het
Btnl9 T C 11: 49,169,568 E451G probably damaging Het
Cblb A G 16: 52,174,370 H658R possibly damaging Het
Cdca2 T C 14: 67,680,284 E555G possibly damaging Het
Chfr A G 5: 110,153,129 S299G possibly damaging Het
Eea1 A G 10: 96,026,054 E741G probably benign Het
Gapvd1 T C 2: 34,693,433 D1057G probably benign Het
Glyat C T 19: 12,650,281 T80M probably benign Het
Gpr87 T C 3: 59,179,326 S253G probably damaging Het
Hmgxb3 A G 18: 61,162,977 S320P probably damaging Het
Kcnq5 C T 1: 21,479,468 G345D probably damaging Het
Kif5c T C 2: 49,758,858 V938A probably benign Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Madd G T 2: 91,170,635 T467K possibly damaging Het
Mamdc4 T C 2: 25,565,878 D706G probably damaging Het
Map2 A G 1: 66,413,133 H476R probably damaging Het
Mpeg1 T C 19: 12,461,693 S172P probably damaging Het
Nup210 C T 6: 91,085,988 V230I probably damaging Het
Olfr1009 G T 2: 85,722,322 A306S probably benign Het
Olfr348 T A 2: 36,787,181 Y219N probably damaging Het
Olfr568 T C 7: 102,877,893 S258P probably damaging Het
Pepd A G 7: 34,942,690 probably null Het
Ppp1r36 T A 12: 76,437,986 W238R probably damaging Het
Ppp1r36 G T 12: 76,437,987 W238L possibly damaging Het
Prpf6 T G 2: 181,608,165 D39E probably benign Het
Rassf5 T A 1: 131,181,195 Q163L possibly damaging Het
Rbm43 T A 2: 51,925,595 T205S probably benign Het
Robo4 CGG CG 9: 37,411,490 probably null Het
Sds C A 5: 120,483,650 Q286K possibly damaging Het
Slc35a3 A T 3: 116,681,190 C184* probably null Het
Smg1 G A 7: 118,139,436 T3530I possibly damaging Het
Sspo T C 6: 48,493,280 V591A probably benign Het
Stam2 T C 2: 52,720,917 D31G probably damaging Het
Star A G 8: 25,809,917 K96E probably damaging Het
Syne3 A G 12: 104,955,672 L495P probably damaging Het
Tceanc2 A T 4: 107,165,649 M47K probably benign Het
Tecpr2 T C 12: 110,914,684 L85P probably damaging Het
Tmem241 C T 18: 12,043,263 R116K probably benign Het
Yipf2 G A 9: 21,592,191 A20V probably benign Het
Zc3h4 T A 7: 16,429,005 D443E unknown Het
Zfp184 T A 13: 21,958,577 V151D probably benign Het
Zhx1 T C 15: 58,053,299 Y517C probably damaging Het
Other mutations in Nkx2-3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01485:Nkx2-3 APN 19 43612655 missense possibly damaging 0.59
R1647:Nkx2-3 UTSW 19 43614456 missense probably damaging 1.00
R4704:Nkx2-3 UTSW 19 43612684 missense probably damaging 0.96
R4718:Nkx2-3 UTSW 19 43612643 missense probably benign 0.08
R5189:Nkx2-3 UTSW 19 43612708 missense probably benign 0.30
R5770:Nkx2-3 UTSW 19 43614533 missense probably damaging 1.00
R7124:Nkx2-3 UTSW 19 43614806 missense possibly damaging 0.84
R7457:Nkx2-3 UTSW 19 43612547 missense probably damaging 1.00
R7843:Nkx2-3 UTSW 19 43614882 missense probably benign 0.02
X0061:Nkx2-3 UTSW 19 43614362 missense probably benign 0.08
Z1177:Nkx2-3 UTSW 19 43614737 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- GGACAATTAAGTGGCCCTGATG -3'
(R):5'- CCTAGCCGAATGTGAAAGGG -3'

Sequencing Primer
(F):5'- TGATGATGTTACCAAGCCCG -3'
(R):5'- CCATGCAGGCACGGTTTG -3'
Posted On2016-10-05