Incidental Mutation 'R0478:4930556J24Rik'
ID43207
Institutional Source Beutler Lab
Gene Symbol 4930556J24Rik
Ensembl Gene ENSMUSG00000034493
Gene NameRIKEN cDNA 4930556J24 gene
Synonyms
MMRRC Submission 038678-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.122) question?
Stock #R0478 (G1)
Quality Score170
Status Validated
Chromosome11
Chromosomal Location3937541-3976778 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to G at 3976259 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000105612 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020705] [ENSMUST00000042344] [ENSMUST00000109985]
Predicted Effect probably benign
Transcript: ENSMUST00000020705
SMART Domains Protein: ENSMUSP00000020705
Gene: ENSMUSG00000020430

DomainStartEndE-ValueType
Pfam:Pescadillo_N 6 286 5.1e-135 PFAM
BRCT 323 404 4.81e-7 SMART
coiled coil region 469 542 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000042344
AA Change: Q48H
SMART Domains Protein: ENSMUSP00000048953
Gene: ENSMUSG00000034493
AA Change: Q48H

DomainStartEndE-ValueType
low complexity region 23 40 N/A INTRINSIC
low complexity region 84 93 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109985
SMART Domains Protein: ENSMUSP00000105612
Gene: ENSMUSG00000020430

DomainStartEndE-ValueType
Pfam:Pescadillo_N 7 284 1.1e-130 PFAM
BRCT 327 408 4.81e-7 SMART
coiled coil region 473 546 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137544
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.0%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 100% (49/49)
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432E11Rik A T 7: 29,562,589 noncoding transcript Het
Acnat1 T G 4: 49,450,901 D70A probably damaging Het
Adnp2 A G 18: 80,129,334 V620A probably benign Het
Aldoart1 T A 4: 72,852,343 H21L probably benign Het
Birc3 A G 9: 7,860,347 V290A probably damaging Het
Bpifb3 C T 2: 153,931,480 probably benign Het
Camta1 C A 4: 151,075,140 R1614L probably damaging Het
Clmn A G 12: 104,785,491 M235T probably damaging Het
Dmbt1 A G 7: 131,041,187 E245G possibly damaging Het
Epgn G T 5: 91,031,128 V36L probably benign Het
Ets2 C A 16: 95,716,262 P346Q probably damaging Het
Fam222b T C 11: 78,153,856 L81P probably damaging Het
Fancf A C 7: 51,861,692 L188R probably damaging Het
Fibin T C 2: 110,362,734 D21G possibly damaging Het
Fzd6 A G 15: 39,034,034 probably null Het
Gbp4 T A 5: 105,119,433 Q540L probably benign Het
Greb1l T A 18: 10,509,281 L531Q probably damaging Het
Il5ra A G 6: 106,738,462 V137A probably benign Het
Kif26a G A 12: 112,175,789 A826T probably damaging Het
Kiz T C 2: 146,942,158 V537A possibly damaging Het
Klhl32 C T 4: 24,792,777 G15D probably damaging Het
Kmt2d G A 15: 98,853,581 probably benign Het
Lbp T C 2: 158,317,528 probably benign Het
Mmp25 T C 17: 23,632,782 T318A probably benign Het
Mrpl50 A G 4: 49,514,513 C53R probably damaging Het
Msl3l2 G C 10: 56,115,315 E45D probably damaging Het
Nfxl1 A G 5: 72,524,645 probably null Het
Noc3l A G 19: 38,810,006 probably null Het
Olfr1126 T A 2: 87,458,026 V287E probably damaging Het
Olfr1375 T C 11: 51,048,712 S202P probably benign Het
Pgm5 A T 19: 24,834,869 S100T possibly damaging Het
Pi4ka C T 16: 17,309,311 G1093S possibly damaging Het
Pitrm1 T A 13: 6,559,395 S350T probably damaging Het
Ptk2b G T 14: 66,213,372 N48K probably damaging Het
Sept3 T C 15: 82,290,806 L172P probably damaging Het
Sirt3 A T 7: 140,878,114 C41S probably benign Het
Sphkap C T 1: 83,278,711 R152H probably damaging Het
St3gal1 T C 15: 67,113,730 Y25C probably damaging Het
Tbc1d31 T C 15: 57,932,536 F175S probably damaging Het
Tfdp2 T A 9: 96,290,583 D43E probably benign Het
Tgm1 G A 14: 55,700,334 Q773* probably null Het
Tmc3 A T 7: 83,622,152 R837S possibly damaging Het
Unc13a A G 8: 71,651,148 V880A possibly damaging Het
Vmn1r237 T A 17: 21,314,819 V268E probably damaging Het
Zan C T 5: 137,400,526 probably benign Het
Zfp760 G T 17: 21,722,014 E57* probably null Het
Other mutations in 4930556J24Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01550:4930556J24Rik APN 11 3937974 missense unknown
P4717OSA:4930556J24Rik UTSW 11 3938178 splice site probably null
P4748:4930556J24Rik UTSW 11 3938178 splice site probably null
R5593:4930556J24Rik UTSW 11 3938027 missense unknown
R5594:4930556J24Rik UTSW 11 3938027 missense unknown
R5698:4930556J24Rik UTSW 11 3976366 missense possibly damaging 0.93
R6081:4930556J24Rik UTSW 11 3938140 missense unknown
R6169:4930556J24Rik UTSW 11 3938005 missense unknown
R6626:4930556J24Rik UTSW 11 3938056 missense unknown
T0975:4930556J24Rik UTSW 11 3937945 frame shift probably null
T0975:4930556J24Rik UTSW 11 3976324 missense unknown
Predicted Primers PCR Primer
(F):5'- TCTCTCCCTACAGAAACTGGCTGC -3'
(R):5'- AAGCCTCCCCACCTGATGATGAAG -3'

Sequencing Primer
(F):5'- AAACTGGCTGCCCTCAGTG -3'
(R):5'- TGATGAAGGCCAATGCTTCAC -3'
Posted On2013-05-23