Incidental Mutation 'R5491:Pbxip1'
ID432075
Institutional Source Beutler Lab
Gene Symbol Pbxip1
Ensembl Gene ENSMUSG00000042613
Gene Namepre B cell leukemia transcription factor interacting protein 1
Synonyms
MMRRC Submission 043052-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.088) question?
Stock #R5491 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location89436706-89450952 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 89443159 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 37 (M37K)
Ref Sequence ENSEMBL: ENSMUSP00000115904 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038942] [ENSMUST00000130858] [ENSMUST00000145753] [ENSMUST00000146630]
Predicted Effect probably benign
Transcript: ENSMUST00000038942
AA Change: M30K

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000040429
Gene: ENSMUSG00000042613
AA Change: M30K

DomainStartEndE-ValueType
low complexity region 142 152 N/A INTRINSIC
low complexity region 162 177 N/A INTRINSIC
transmembrane domain 187 209 N/A INTRINSIC
coiled coil region 270 350 N/A INTRINSIC
coiled coil region 379 405 N/A INTRINSIC
low complexity region 672 691 N/A INTRINSIC
low complexity region 692 703 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000130858
AA Change: M37K

PolyPhen 2 Score 0.051 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000118496
Gene: ENSMUSG00000042613
AA Change: M37K

DomainStartEndE-ValueType
low complexity region 149 159 N/A INTRINSIC
low complexity region 169 184 N/A INTRINSIC
transmembrane domain 194 216 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141340
Predicted Effect probably benign
Transcript: ENSMUST00000145753
AA Change: M30K

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000121658
Gene: ENSMUSG00000042613
AA Change: M30K

DomainStartEndE-ValueType
low complexity region 142 152 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000146630
AA Change: M37K

PolyPhen 2 Score 0.091 (Sensitivity: 0.93; Specificity: 0.85)
Coding Region Coverage
  • 1x: 98.2%
  • 3x: 97.2%
  • 10x: 95.0%
  • 20x: 89.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene interacts with the PBX1 homeodomain protein, inhibiting its transcriptional activation potential by preventing its binding to DNA. The encoded protein, which is primarily cytosolic but can shuttle to the nucleus, also can interact with estrogen receptors alpha and beta and promote the proliferation of breast cancer, brain tumors, and lung cancer. Several transcript variants encoding different isoforms have been found for this gene. More variants exist, but their full-length natures have yet to be determined. [provided by RefSeq, Dec 2015]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810041L15Rik C A 15: 84,406,510 V199L probably benign Het
A1cf G T 19: 31,918,062 A182S possibly damaging Het
Aldh1l2 A T 10: 83,522,785 D2E probably benign Het
Bach2 G T 4: 32,562,681 D383Y probably damaging Het
Cd248 T C 19: 5,070,209 L695P probably damaging Het
Cela1 T A 15: 100,682,980 N132Y probably damaging Het
Cisd2 A T 3: 135,408,840 D123E probably damaging Het
Col6a6 T A 9: 105,738,236 D1571V probably damaging Het
Fam71e2 T C 7: 4,757,926 I596V probably benign Het
Fbxo48 C T 11: 16,954,280 T144M probably damaging Het
Fbxo7 C A 10: 86,048,026 P497Q probably damaging Het
Gm12695 T A 4: 96,769,668 H88L possibly damaging Het
Gm8994 C G 6: 136,329,557 R339G probably damaging Het
Gpat4 A G 8: 23,180,664 I133T probably benign Het
Hmcn1 C T 1: 150,609,825 probably null Het
Ncaph T C 2: 127,123,675 T252A probably benign Het
Nebl G T 2: 17,434,972 Y163* probably null Het
Neurod4 C T 10: 130,271,067 V113I possibly damaging Het
Olfr1305 T A 2: 111,873,562 I98F probably benign Het
Olfr411 A T 11: 74,346,914 H103Q probably benign Het
Olfr71 A G 4: 43,705,990 S193P probably damaging Het
Phactr2 T C 10: 13,261,846 N184S possibly damaging Het
Phf20l1 C T 15: 66,615,785 P480L possibly damaging Het
Psme4 T C 11: 30,815,246 S538P possibly damaging Het
Rassf1 T A 9: 107,561,415 M228K possibly damaging Het
Rpn2 A G 2: 157,297,383 D231G probably damaging Het
She A T 3: 89,831,790 D96V probably damaging Het
Tmem260 T A 14: 48,512,170 probably null Het
Ttn T A 2: 76,732,358 I28751F probably damaging Het
Zfp60 T G 7: 27,748,515 probably null Het
Other mutations in Pbxip1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01599:Pbxip1 APN 3 89443590 splice site probably benign
IGL02612:Pbxip1 APN 3 89443681 missense probably damaging 1.00
IGL02718:Pbxip1 APN 3 89448004 missense probably damaging 1.00
R0538:Pbxip1 UTSW 3 89447619 missense possibly damaging 0.79
R0549:Pbxip1 UTSW 3 89443592 splice site probably benign
R1460:Pbxip1 UTSW 3 89445614 missense probably damaging 1.00
R1931:Pbxip1 UTSW 3 89447677 splice site probably null
R1966:Pbxip1 UTSW 3 89445488 missense probably damaging 1.00
R2008:Pbxip1 UTSW 3 89448713 missense probably benign 0.20
R3435:Pbxip1 UTSW 3 89447236 missense probably damaging 0.99
R4504:Pbxip1 UTSW 3 89446383 missense possibly damaging 0.48
R4591:Pbxip1 UTSW 3 89446160 missense probably benign 0.33
R6051:Pbxip1 UTSW 3 89443170 missense probably benign 0.08
R6620:Pbxip1 UTSW 3 89447826 missense probably benign 0.12
R7203:Pbxip1 UTSW 3 89447428 missense possibly damaging 0.68
R7259:Pbxip1 UTSW 3 89445633 missense probably benign
R7604:Pbxip1 UTSW 3 89445595 missense probably benign 0.01
R7687:Pbxip1 UTSW 3 89448199 missense probably damaging 1.00
R7710:Pbxip1 UTSW 3 89448101 missense probably damaging 1.00
R7980:Pbxip1 UTSW 3 89446341 missense probably benign 0.44
R8218:Pbxip1 UTSW 3 89445595 missense probably benign
R8754:Pbxip1 UTSW 3 89447928 missense probably damaging 1.00
R8923:Pbxip1 UTSW 3 89445614 missense possibly damaging 0.78
R8951:Pbxip1 UTSW 3 89445557 missense probably benign 0.05
X0012:Pbxip1 UTSW 3 89445523 missense possibly damaging 0.91
X0012:Pbxip1 UTSW 3 89446383 missense possibly damaging 0.48
Z1177:Pbxip1 UTSW 3 89447220 missense probably benign 0.30
Predicted Primers PCR Primer
(F):5'- TTGGATAGCACCAGGGTAGAGC -3'
(R):5'- AGAGTGGCAGCTCATAAGGC -3'

Sequencing Primer
(F):5'- CAGGCTGCAGTTTCTGAGATG -3'
(R):5'- TGGCAGCTCATAAGGCCAGAC -3'
Posted On2016-10-05