Incidental Mutation 'R5491:Bach2'
ID432078
Institutional Source Beutler Lab
Gene Symbol Bach2
Ensembl Gene ENSMUSG00000040270
Gene NameBTB and CNC homology, basic leucine zipper transcription factor 2
Synonyms
MMRRC Submission 043052-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5491 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location32238804-32586108 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 32562681 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Tyrosine at position 383 (D383Y)
Ref Sequence ENSEMBL: ENSMUSP00000131592 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037416] [ENSMUST00000108180] [ENSMUST00000171600]
Predicted Effect probably damaging
Transcript: ENSMUST00000037416
AA Change: D383Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000043693
Gene: ENSMUSG00000040270
AA Change: D383Y

DomainStartEndE-ValueType
BTB 37 133 3.21e-28 SMART
low complexity region 276 287 N/A INTRINSIC
low complexity region 313 326 N/A INTRINSIC
low complexity region 328 343 N/A INTRINSIC
BRLZ 520 584 2.3e-14 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000108180
AA Change: D383Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103815
Gene: ENSMUSG00000040270
AA Change: D383Y

DomainStartEndE-ValueType
BTB 37 133 3.21e-28 SMART
low complexity region 276 287 N/A INTRINSIC
low complexity region 313 326 N/A INTRINSIC
low complexity region 328 343 N/A INTRINSIC
low complexity region 514 527 N/A INTRINSIC
BRLZ 643 707 2.3e-14 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126225
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136149
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149084
Predicted Effect probably damaging
Transcript: ENSMUST00000171600
AA Change: D383Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000131592
Gene: ENSMUSG00000040270
AA Change: D383Y

DomainStartEndE-ValueType
BTB 37 133 3.21e-28 SMART
low complexity region 276 287 N/A INTRINSIC
low complexity region 313 326 N/A INTRINSIC
low complexity region 328 343 N/A INTRINSIC
low complexity region 514 527 N/A INTRINSIC
BRLZ 643 707 2.3e-14 SMART
Coding Region Coverage
  • 1x: 98.2%
  • 3x: 97.2%
  • 10x: 95.0%
  • 20x: 89.9%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous null mice display impaired B cell differentiation and reduced B cell numbers. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810041L15Rik C A 15: 84,406,510 V199L probably benign Het
A1cf G T 19: 31,918,062 A182S possibly damaging Het
Aldh1l2 A T 10: 83,522,785 D2E probably benign Het
Cd248 T C 19: 5,070,209 L695P probably damaging Het
Cela1 T A 15: 100,682,980 N132Y probably damaging Het
Cisd2 A T 3: 135,408,840 D123E probably damaging Het
Col6a6 T A 9: 105,738,236 D1571V probably damaging Het
Fam71e2 T C 7: 4,757,926 I596V probably benign Het
Fbxo48 C T 11: 16,954,280 T144M probably damaging Het
Fbxo7 C A 10: 86,048,026 P497Q probably damaging Het
Gm12695 T A 4: 96,769,668 H88L possibly damaging Het
Gm8994 C G 6: 136,329,557 R339G probably damaging Het
Gpat4 A G 8: 23,180,664 I133T probably benign Het
Hmcn1 C T 1: 150,609,825 probably null Het
Ncaph T C 2: 127,123,675 T252A probably benign Het
Nebl G T 2: 17,434,972 Y163* probably null Het
Neurod4 C T 10: 130,271,067 V113I possibly damaging Het
Olfr1305 T A 2: 111,873,562 I98F probably benign Het
Olfr411 A T 11: 74,346,914 H103Q probably benign Het
Olfr71 A G 4: 43,705,990 S193P probably damaging Het
Pbxip1 T A 3: 89,443,159 M37K probably benign Het
Phactr2 T C 10: 13,261,846 N184S possibly damaging Het
Phf20l1 C T 15: 66,615,785 P480L possibly damaging Het
Psme4 T C 11: 30,815,246 S538P possibly damaging Het
Rassf1 T A 9: 107,561,415 M228K possibly damaging Het
Rpn2 A G 2: 157,297,383 D231G probably damaging Het
She A T 3: 89,831,790 D96V probably damaging Het
Tmem260 T A 14: 48,512,170 probably null Het
Ttn T A 2: 76,732,358 I28751F probably damaging Het
Zfp60 T G 7: 27,748,515 probably null Het
Other mutations in Bach2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01749:Bach2 APN 4 32580261 missense probably damaging 1.00
IGL02137:Bach2 APN 4 32501621 start gained probably benign
IGL02281:Bach2 APN 4 32562513 missense possibly damaging 0.78
IGL02333:Bach2 APN 4 32575334 nonsense probably null
IGL02369:Bach2 APN 4 32579975 missense possibly damaging 0.85
IGL02533:Bach2 APN 4 32562451 missense probably benign 0.00
Magnificat UTSW 4 32563324 missense probably damaging 1.00
R0011:Bach2 UTSW 4 32244655 intron probably benign
R1240:Bach2 UTSW 4 32563198 missense probably damaging 1.00
R1501:Bach2 UTSW 4 32562279 missense possibly damaging 0.86
R2004:Bach2 UTSW 4 32580055 missense probably benign 0.36
R2171:Bach2 UTSW 4 32501662 missense probably damaging 0.97
R3827:Bach2 UTSW 4 32563150 missense probably damaging 1.00
R3829:Bach2 UTSW 4 32563150 missense probably damaging 1.00
R3830:Bach2 UTSW 4 32563150 missense probably damaging 1.00
R4564:Bach2 UTSW 4 32563338 missense probably damaging 1.00
R4660:Bach2 UTSW 4 32562777 missense probably benign
R5132:Bach2 UTSW 4 32563396 intron probably benign
R5307:Bach2 UTSW 4 32562683 missense probably benign 0.11
R5860:Bach2 UTSW 4 32580268 missense probably damaging 1.00
R5983:Bach2 UTSW 4 32563324 missense probably damaging 1.00
R6331:Bach2 UTSW 4 32238816 start gained probably benign
R6770:Bach2 UTSW 4 32575240 missense possibly damaging 0.81
R6806:Bach2 UTSW 4 32575301 missense possibly damaging 0.66
R7146:Bach2 UTSW 4 32562670 missense probably damaging 1.00
R7691:Bach2 UTSW 4 32580271 missense probably damaging 1.00
R8062:Bach2 UTSW 4 32562937 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTCGAGATGGACCGAAAAC -3'
(R):5'- AGTGTTCGGTTGGTCACACG -3'

Sequencing Primer
(F):5'- AGTACCCCTACTGGAGCCG -3'
(R):5'- TTGGTCACACGCGCTTG -3'
Posted On2016-10-05