Incidental Mutation 'R5491:Fam71e2'
ID 432082
Institutional Source Beutler Lab
Gene Symbol Fam71e2
Ensembl Gene ENSMUSG00000092518
Gene Name family with sequence similarity 71, member E2
Synonyms
MMRRC Submission 043052-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.086) question?
Stock # R5491 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 4753226-4771302 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 4757926 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 596 (I596V)
Ref Sequence ENSEMBL: ENSMUSP00000133885 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063324] [ENSMUST00000163574] [ENSMUST00000174409] [ENSMUST00000182048] [ENSMUST00000182111] [ENSMUST00000182173] [ENSMUST00000182738] [ENSMUST00000183334] [ENSMUST00000183971] [ENSMUST00000184143]
AlphaFold L7N480
Predicted Effect probably benign
Transcript: ENSMUST00000063324
SMART Domains Protein: ENSMUSP00000064988
Gene: ENSMUSG00000051811

DomainStartEndE-ValueType
Pfam:COX6B 21 85 2.7e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108580
AA Change: I596V

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000134691
Gene: ENSMUSG00000092518
AA Change: I596V

DomainStartEndE-ValueType
low complexity region 12 22 N/A INTRINSIC
Pfam:DUF3699 99 172 6.5e-23 PFAM
low complexity region 282 296 N/A INTRINSIC
low complexity region 684 697 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163574
SMART Domains Protein: ENSMUSP00000137684
Gene: ENSMUSG00000092518

DomainStartEndE-ValueType
low complexity region 7 17 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174409
AA Change: I596V

PolyPhen 2 Score 0.050 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000133885
Gene: ENSMUSG00000092518
AA Change: I596V

DomainStartEndE-ValueType
low complexity region 7 17 N/A INTRINSIC
Pfam:DUF3699 93 168 5.8e-24 PFAM
low complexity region 277 291 N/A INTRINSIC
low complexity region 679 692 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000182048
SMART Domains Protein: ENSMUSP00000138765
Gene: ENSMUSG00000051811

DomainStartEndE-ValueType
Pfam:COX6B 21 85 2.7e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000182111
SMART Domains Protein: ENSMUSP00000138709
Gene: ENSMUSG00000051811

DomainStartEndE-ValueType
Pfam:COX6B 21 85 2.7e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000182173
SMART Domains Protein: ENSMUSP00000138288
Gene: ENSMUSG00000051811

DomainStartEndE-ValueType
Pfam:COX6B 21 74 5e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000182738
SMART Domains Protein: ENSMUSP00000138744
Gene: ENSMUSG00000051811

DomainStartEndE-ValueType
Pfam:COX6B 21 74 5.9e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000183334
Predicted Effect probably benign
Transcript: ENSMUST00000183971
SMART Domains Protein: ENSMUSP00000138911
Gene: ENSMUSG00000051811

DomainStartEndE-ValueType
Pfam:COX6B 21 75 1.7e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000184143
SMART Domains Protein: ENSMUSP00000139239
Gene: ENSMUSG00000051811

DomainStartEndE-ValueType
Pfam:COX6B 21 60 2.1e-11 PFAM
Coding Region Coverage
  • 1x: 98.2%
  • 3x: 97.2%
  • 10x: 95.0%
  • 20x: 89.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810041L15Rik C A 15: 84,406,510 V199L probably benign Het
A1cf G T 19: 31,918,062 A182S possibly damaging Het
Aldh1l2 A T 10: 83,522,785 D2E probably benign Het
Bach2 G T 4: 32,562,681 D383Y probably damaging Het
Cd248 T C 19: 5,070,209 L695P probably damaging Het
Cela1 T A 15: 100,682,980 N132Y probably damaging Het
Cisd2 A T 3: 135,408,840 D123E probably damaging Het
Col6a6 T A 9: 105,738,236 D1571V probably damaging Het
Fbxo48 C T 11: 16,954,280 T144M probably damaging Het
Fbxo7 C A 10: 86,048,026 P497Q probably damaging Het
Gm12695 T A 4: 96,769,668 H88L possibly damaging Het
Gm8994 C G 6: 136,329,557 R339G probably damaging Het
Gpat4 A G 8: 23,180,664 I133T probably benign Het
Hmcn1 C T 1: 150,609,825 probably null Het
Ncaph T C 2: 127,123,675 T252A probably benign Het
Nebl G T 2: 17,434,972 Y163* probably null Het
Neurod4 C T 10: 130,271,067 V113I possibly damaging Het
Olfr1305 T A 2: 111,873,562 I98F probably benign Het
Olfr411 A T 11: 74,346,914 H103Q probably benign Het
Olfr71 A G 4: 43,705,990 S193P probably damaging Het
Pbxip1 T A 3: 89,443,159 M37K probably benign Het
Phactr2 T C 10: 13,261,846 N184S possibly damaging Het
Phf20l1 C T 15: 66,615,785 P480L possibly damaging Het
Psme4 T C 11: 30,815,246 S538P possibly damaging Het
Rassf1 T A 9: 107,561,415 M228K possibly damaging Het
Rpn2 A G 2: 157,297,383 D231G probably damaging Het
She A T 3: 89,831,790 D96V probably damaging Het
Tmem260 T A 14: 48,512,170 probably null Het
Ttn T A 2: 76,732,358 I28751F probably damaging Het
Zfp60 T G 7: 27,748,515 probably null Het
Other mutations in Fam71e2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00984:Fam71e2 APN 7 4757527 missense probably damaging 0.99
IGL01622:Fam71e2 APN 7 4758723 missense probably benign 0.16
IGL01623:Fam71e2 APN 7 4758723 missense probably benign 0.16
IGL01944:Fam71e2 APN 7 4770695 missense possibly damaging 0.94
IGL03013:Fam71e2 APN 7 4758633 missense probably benign 0.14
IGL03029:Fam71e2 APN 7 4757840 missense possibly damaging 0.78
R0153:Fam71e2 UTSW 7 4770287 missense probably damaging 0.99
R0523:Fam71e2 UTSW 7 4759393 missense possibly damaging 0.74
R0981:Fam71e2 UTSW 7 4757589 splice site probably null
R1428:Fam71e2 UTSW 7 4757688 missense possibly damaging 0.68
R1736:Fam71e2 UTSW 7 4758154 missense probably damaging 1.00
R1929:Fam71e2 UTSW 7 4758187 missense probably benign 0.00
R1993:Fam71e2 UTSW 7 4758018 missense probably damaging 1.00
R2016:Fam71e2 UTSW 7 4759398 missense probably damaging 1.00
R2256:Fam71e2 UTSW 7 4771021 missense probably benign 0.01
R2270:Fam71e2 UTSW 7 4758187 missense probably benign 0.00
R2271:Fam71e2 UTSW 7 4758187 missense probably benign 0.00
R2272:Fam71e2 UTSW 7 4758187 missense probably benign 0.00
R4288:Fam71e2 UTSW 7 4770723 missense possibly damaging 0.91
R4653:Fam71e2 UTSW 7 4758055 missense possibly damaging 0.95
R4812:Fam71e2 UTSW 7 4759072 missense probably damaging 1.00
R4860:Fam71e2 UTSW 7 4757469 critical splice donor site probably null
R4860:Fam71e2 UTSW 7 4757469 critical splice donor site probably null
R5037:Fam71e2 UTSW 7 4758576 missense possibly damaging 0.64
R5044:Fam71e2 UTSW 7 4758661 missense probably benign 0.00
R5559:Fam71e2 UTSW 7 4758450 missense probably damaging 1.00
R5919:Fam71e2 UTSW 7 4770386 missense possibly damaging 0.92
R6025:Fam71e2 UTSW 7 4758144 missense probably benign 0.01
R6038:Fam71e2 UTSW 7 4753595 splice site probably null
R6038:Fam71e2 UTSW 7 4753595 splice site probably null
R6164:Fam71e2 UTSW 7 4770678 missense probably damaging 0.99
R6371:Fam71e2 UTSW 7 4759359 missense probably benign 0.06
R6470:Fam71e2 UTSW 7 4757851 missense probably benign 0.16
R6546:Fam71e2 UTSW 7 4758465 missense probably benign 0.06
R6603:Fam71e2 UTSW 7 4758432 missense possibly damaging 0.95
R7037:Fam71e2 UTSW 7 4758585 utr 3 prime probably benign
R7381:Fam71e2 UTSW 7 4757682 missense
R8743:Fam71e2 UTSW 7 4757815 missense
R9066:Fam71e2 UTSW 7 4770519 intron probably benign
R9072:Fam71e2 UTSW 7 4759254 missense
R9138:Fam71e2 UTSW 7 4770407 missense
R9352:Fam71e2 UTSW 7 4758606 missense
R9373:Fam71e2 UTSW 7 4757713 missense
R9462:Fam71e2 UTSW 7 4758331 missense
Z1177:Fam71e2 UTSW 7 4757728 missense
Predicted Primers PCR Primer
(F):5'- TCTGTGTAGGGGTTCTCAACAG -3'
(R):5'- GGTCTCAGAAGGATCCAACTG -3'

Sequencing Primer
(F):5'- GTAGGGGTTCTCAACAGCTATCTC -3'
(R):5'- GAAAGCTCTCAACTCCCGGG -3'
Posted On 2016-10-05