Incidental Mutation 'R5491:Gpat4'
ID 432084
Institutional Source Beutler Lab
Gene Symbol Gpat4
Ensembl Gene ENSMUSG00000031545
Gene Name glycerol-3-phosphate acyltransferase 4
Synonyms Agpat6
MMRRC Submission 043052-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.387) question?
Stock # R5491 (G1)
Quality Score 225
Status Not validated
Chromosome 8
Chromosomal Location 23171265-23208346 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 23180664 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 133 (I133T)
Ref Sequence ENSEMBL: ENSMUSP00000147679 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000167004] [ENSMUST00000209507]
AlphaFold Q8K2C8
Predicted Effect probably benign
Transcript: ENSMUST00000167004
AA Change: I255T

PolyPhen 2 Score 0.105 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000127325
Gene: ENSMUSG00000031545
AA Change: I255T

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
transmembrane domain 156 175 N/A INTRINSIC
transmembrane domain 180 202 N/A INTRINSIC
PlsC 242 353 9.31e-24 SMART
Blast:PlsC 368 413 7e-18 BLAST
low complexity region 414 425 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000209507
AA Change: I133T

PolyPhen 2 Score 0.381 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210782
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210992
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211260
Coding Region Coverage
  • 1x: 98.2%
  • 3x: 97.2%
  • 10x: 95.0%
  • 20x: 89.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Lysophosphatidic acid acyltransferases (EC 2.3.1.51) catalyze the conversion of lysophosphatidic acid (LPA) to phosphatidic acid (PA). LPA and PA are involved in signal transduction and lipid biosynthesis.[supplied by OMIM, Apr 2004]
PHENOTYPE: Nursing mothers homozygous for a gene trap allele display underdeveloped mammary glands that are depleted in intracellular fat droplets and lack the ability to produce diacylglycerol- and triacylglycerol-rich milk; pups nursed by mutant mothers die neonatally unless transferred to foster mothers. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810041L15Rik C A 15: 84,406,510 V199L probably benign Het
A1cf G T 19: 31,918,062 A182S possibly damaging Het
Aldh1l2 A T 10: 83,522,785 D2E probably benign Het
Bach2 G T 4: 32,562,681 D383Y probably damaging Het
Cd248 T C 19: 5,070,209 L695P probably damaging Het
Cela1 T A 15: 100,682,980 N132Y probably damaging Het
Cisd2 A T 3: 135,408,840 D123E probably damaging Het
Col6a6 T A 9: 105,738,236 D1571V probably damaging Het
Fam71e2 T C 7: 4,757,926 I596V probably benign Het
Fbxo48 C T 11: 16,954,280 T144M probably damaging Het
Fbxo7 C A 10: 86,048,026 P497Q probably damaging Het
Gm12695 T A 4: 96,769,668 H88L possibly damaging Het
Gm8994 C G 6: 136,329,557 R339G probably damaging Het
Hmcn1 C T 1: 150,609,825 probably null Het
Ncaph T C 2: 127,123,675 T252A probably benign Het
Nebl G T 2: 17,434,972 Y163* probably null Het
Neurod4 C T 10: 130,271,067 V113I possibly damaging Het
Olfr1305 T A 2: 111,873,562 I98F probably benign Het
Olfr411 A T 11: 74,346,914 H103Q probably benign Het
Olfr71 A G 4: 43,705,990 S193P probably damaging Het
Pbxip1 T A 3: 89,443,159 M37K probably benign Het
Phactr2 T C 10: 13,261,846 N184S possibly damaging Het
Phf20l1 C T 15: 66,615,785 P480L possibly damaging Het
Psme4 T C 11: 30,815,246 S538P possibly damaging Het
Rassf1 T A 9: 107,561,415 M228K possibly damaging Het
Rpn2 A G 2: 157,297,383 D231G probably damaging Het
She A T 3: 89,831,790 D96V probably damaging Het
Tmem260 T A 14: 48,512,170 probably null Het
Ttn T A 2: 76,732,358 I28751F probably damaging Het
Zfp60 T G 7: 27,748,515 probably null Het
Other mutations in Gpat4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00579:Gpat4 APN 8 23182775 missense probably damaging 0.97
IGL01660:Gpat4 APN 8 23175338 critical splice donor site probably null
IGL01688:Gpat4 APN 8 23181845 missense probably benign 0.03
IGL02749:Gpat4 APN 8 23180870 missense probably damaging 1.00
R0076:Gpat4 UTSW 8 23190705 splice site probably benign
R0362:Gpat4 UTSW 8 23180933 missense probably benign 0.05
R0961:Gpat4 UTSW 8 23180911 missense probably damaging 0.96
R1876:Gpat4 UTSW 8 23179470 missense possibly damaging 0.82
R1959:Gpat4 UTSW 8 23182936 missense possibly damaging 0.81
R2217:Gpat4 UTSW 8 23180155 missense probably damaging 0.97
R2313:Gpat4 UTSW 8 23180155 missense probably damaging 0.97
R2315:Gpat4 UTSW 8 23180155 missense probably damaging 0.97
R2969:Gpat4 UTSW 8 23180155 missense probably damaging 0.97
R3110:Gpat4 UTSW 8 23180155 missense probably damaging 0.97
R3112:Gpat4 UTSW 8 23180155 missense probably damaging 0.97
R3774:Gpat4 UTSW 8 23180155 missense probably damaging 0.97
R3775:Gpat4 UTSW 8 23180155 missense probably damaging 0.97
R3826:Gpat4 UTSW 8 23180155 missense probably damaging 0.97
R3828:Gpat4 UTSW 8 23180155 missense probably damaging 0.97
R3829:Gpat4 UTSW 8 23180155 missense probably damaging 0.97
R3830:Gpat4 UTSW 8 23180155 missense probably damaging 0.97
R3943:Gpat4 UTSW 8 23180155 missense probably damaging 0.97
R3944:Gpat4 UTSW 8 23180155 missense probably damaging 0.97
R4384:Gpat4 UTSW 8 23174586 missense probably benign 0.05
R4685:Gpat4 UTSW 8 23182849 utr 5 prime probably benign
R5120:Gpat4 UTSW 8 23180202 missense possibly damaging 0.77
R5199:Gpat4 UTSW 8 23182696 missense possibly damaging 0.46
R8393:Gpat4 UTSW 8 23179482 unclassified probably benign
R8395:Gpat4 UTSW 8 23179482 unclassified probably benign
R8396:Gpat4 UTSW 8 23179482 unclassified probably benign
X0062:Gpat4 UTSW 8 23190711 splice site probably null
X0064:Gpat4 UTSW 8 23175394 missense probably damaging 1.00
Z1176:Gpat4 UTSW 8 23179798 missense probably benign
Predicted Primers PCR Primer
(F):5'- GAAATAGACCTCTCCCTTCAGG -3'
(R):5'- GAGACTCGGTCACATTTGGC -3'

Sequencing Primer
(F):5'- TTCCTCATCAGCAGTCTAAGGACG -3'
(R):5'- CACATTTGGCTGCTGATGC -3'
Posted On 2016-10-05