Incidental Mutation 'R5491:Phactr2'
ID 432087
Institutional Source Beutler Lab
Gene Symbol Phactr2
Ensembl Gene ENSMUSG00000062866
Gene Name phosphatase and actin regulator 2
Synonyms
MMRRC Submission 043052-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R5491 (G1)
Quality Score 225
Status Not validated
Chromosome 10
Chromosomal Location 13207717-13474412 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 13261846 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 184 (N184S)
Ref Sequence ENSEMBL: ENSMUSP00000101184 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079698] [ENSMUST00000105543] [ENSMUST00000105545] [ENSMUST00000105546]
AlphaFold B1AVP0
Predicted Effect probably benign
Transcript: ENSMUST00000079698
AA Change: N114S

PolyPhen 2 Score 0.028 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000078637
Gene: ENSMUSG00000062866
AA Change: N114S

DomainStartEndE-ValueType
low complexity region 39 54 N/A INTRINSIC
RPEL 60 85 7.44e-6 SMART
low complexity region 154 179 N/A INTRINSIC
low complexity region 208 218 N/A INTRINSIC
low complexity region 250 270 N/A INTRINSIC
low complexity region 378 388 N/A INTRINSIC
RPEL 403 428 5.81e-8 SMART
RPEL 441 466 1.36e-8 SMART
RPEL 479 504 1.64e-7 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000105543
AA Change: N125S

PolyPhen 2 Score 0.888 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000101182
Gene: ENSMUSG00000062866
AA Change: N125S

DomainStartEndE-ValueType
low complexity region 50 65 N/A INTRINSIC
RPEL 71 96 7.44e-6 SMART
low complexity region 165 190 N/A INTRINSIC
low complexity region 219 229 N/A INTRINSIC
low complexity region 261 281 N/A INTRINSIC
low complexity region 389 399 N/A INTRINSIC
RPEL 414 439 5.81e-8 SMART
RPEL 452 477 1.36e-8 SMART
RPEL 490 515 1.64e-7 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000105545
AA Change: N184S

PolyPhen 2 Score 0.913 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000101184
Gene: ENSMUSG00000062866
AA Change: N184S

DomainStartEndE-ValueType
low complexity region 50 65 N/A INTRINSIC
RPEL 71 96 7.44e-6 SMART
low complexity region 157 182 N/A INTRINSIC
low complexity region 211 221 N/A INTRINSIC
low complexity region 253 273 N/A INTRINSIC
low complexity region 381 391 N/A INTRINSIC
RPEL 406 431 5.81e-8 SMART
RPEL 444 469 1.36e-8 SMART
RPEL 482 507 1.64e-7 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000105546
AA Change: N114S

PolyPhen 2 Score 0.812 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000101185
Gene: ENSMUSG00000062866
AA Change: N114S

DomainStartEndE-ValueType
low complexity region 39 54 N/A INTRINSIC
RPEL 60 85 7.44e-6 SMART
low complexity region 133 144 N/A INTRINSIC
low complexity region 149 184 N/A INTRINSIC
low complexity region 199 213 N/A INTRINSIC
low complexity region 226 251 N/A INTRINSIC
low complexity region 280 290 N/A INTRINSIC
low complexity region 322 342 N/A INTRINSIC
low complexity region 450 460 N/A INTRINSIC
RPEL 475 500 5.81e-8 SMART
RPEL 513 538 1.36e-8 SMART
RPEL 551 576 1.64e-7 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000105547
AA Change: N184S

PolyPhen 2 Score 0.904 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000101186
Gene: ENSMUSG00000062866
AA Change: N184S

DomainStartEndE-ValueType
low complexity region 12 36 N/A INTRINSIC
low complexity region 50 65 N/A INTRINSIC
low complexity region 109 124 N/A INTRINSIC
RPEL 130 155 7.44e-6 SMART
low complexity region 224 249 N/A INTRINSIC
low complexity region 278 288 N/A INTRINSIC
low complexity region 320 340 N/A INTRINSIC
low complexity region 448 458 N/A INTRINSIC
RPEL 473 498 5.81e-8 SMART
RPEL 511 536 1.36e-8 SMART
RPEL 549 574 1.64e-7 SMART
Coding Region Coverage
  • 1x: 98.2%
  • 3x: 97.2%
  • 10x: 95.0%
  • 20x: 89.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810041L15Rik C A 15: 84,406,510 V199L probably benign Het
A1cf G T 19: 31,918,062 A182S possibly damaging Het
Aldh1l2 A T 10: 83,522,785 D2E probably benign Het
Bach2 G T 4: 32,562,681 D383Y probably damaging Het
Cd248 T C 19: 5,070,209 L695P probably damaging Het
Cela1 T A 15: 100,682,980 N132Y probably damaging Het
Cisd2 A T 3: 135,408,840 D123E probably damaging Het
Col6a6 T A 9: 105,738,236 D1571V probably damaging Het
Fam71e2 T C 7: 4,757,926 I596V probably benign Het
Fbxo48 C T 11: 16,954,280 T144M probably damaging Het
Fbxo7 C A 10: 86,048,026 P497Q probably damaging Het
Gm12695 T A 4: 96,769,668 H88L possibly damaging Het
Gm8994 C G 6: 136,329,557 R339G probably damaging Het
Gpat4 A G 8: 23,180,664 I133T probably benign Het
Hmcn1 C T 1: 150,609,825 probably null Het
Ncaph T C 2: 127,123,675 T252A probably benign Het
Nebl G T 2: 17,434,972 Y163* probably null Het
Neurod4 C T 10: 130,271,067 V113I possibly damaging Het
Olfr1305 T A 2: 111,873,562 I98F probably benign Het
Olfr411 A T 11: 74,346,914 H103Q probably benign Het
Olfr71 A G 4: 43,705,990 S193P probably damaging Het
Pbxip1 T A 3: 89,443,159 M37K probably benign Het
Phf20l1 C T 15: 66,615,785 P480L possibly damaging Het
Psme4 T C 11: 30,815,246 S538P possibly damaging Het
Rassf1 T A 9: 107,561,415 M228K possibly damaging Het
Rpn2 A G 2: 157,297,383 D231G probably damaging Het
She A T 3: 89,831,790 D96V probably damaging Het
Tmem260 T A 14: 48,512,170 probably null Het
Ttn T A 2: 76,732,358 I28751F probably damaging Het
Zfp60 T G 7: 27,748,515 probably null Het
Other mutations in Phactr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00335:Phactr2 APN 10 13245535 missense probably damaging 1.00
IGL01844:Phactr2 APN 10 13253437 missense probably benign 0.05
IGL01893:Phactr2 APN 10 13247188 missense probably benign 0.38
IGL02458:Phactr2 APN 10 13261828 missense probably damaging 1.00
IGL02612:Phactr2 APN 10 13245423 missense probably damaging 0.99
IGL02620:Phactr2 APN 10 13291888 missense probably damaging 1.00
IGL03064:Phactr2 APN 10 13388713 utr 5 prime probably benign
IGL03493:Phactr2 APN 10 13257669 missense probably benign 0.02
R0973:Phactr2 UTSW 10 13247139 missense possibly damaging 0.88
R0973:Phactr2 UTSW 10 13247139 missense possibly damaging 0.88
R0974:Phactr2 UTSW 10 13247139 missense possibly damaging 0.88
R1480:Phactr2 UTSW 10 13253792 missense possibly damaging 0.74
R3115:Phactr2 UTSW 10 13261901 nonsense probably null
R3116:Phactr2 UTSW 10 13261901 nonsense probably null
R3713:Phactr2 UTSW 10 13388732 start gained probably benign
R4367:Phactr2 UTSW 10 13253820 missense probably damaging 1.00
R4368:Phactr2 UTSW 10 13253820 missense probably damaging 1.00
R4371:Phactr2 UTSW 10 13253820 missense probably damaging 1.00
R5344:Phactr2 UTSW 10 13253616 missense possibly damaging 0.76
R5617:Phactr2 UTSW 10 13474065 missense possibly damaging 0.60
R5656:Phactr2 UTSW 10 13388703 missense probably benign 0.34
R5895:Phactr2 UTSW 10 13245517 missense probably damaging 1.00
R6051:Phactr2 UTSW 10 13261811 splice site probably null 0.00
R6317:Phactr2 UTSW 10 13261882 missense probably damaging 0.98
R7048:Phactr2 UTSW 10 13245424 missense probably benign 0.28
R7101:Phactr2 UTSW 10 13247178 missense probably benign 0.00
R7221:Phactr2 UTSW 10 13247039 missense possibly damaging 0.58
R7868:Phactr2 UTSW 10 13232609 missense probably damaging 1.00
R8408:Phactr2 UTSW 10 13253826 missense probably damaging 1.00
R8865:Phactr2 UTSW 10 13253732 missense probably benign 0.00
R9095:Phactr2 UTSW 10 13253642 missense probably benign 0.26
R9443:Phactr2 UTSW 10 13247097 missense probably benign 0.00
RF023:Phactr2 UTSW 10 13245434 missense probably benign 0.10
X0026:Phactr2 UTSW 10 13257634 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCAGAGGGCACACTATAACTGG -3'
(R):5'- ACGAACCTAGATCCTGCAGTC -3'

Sequencing Primer
(F):5'- GGGCACACTATAACTGGATGTCTC -3'
(R):5'- CTAGATCCTGCAGTCCTAGTGAATG -3'
Posted On 2016-10-05