Mutagenetix > Incidental Mutation

Incidental Mutation 'R5491:Aldh1l2'

432088

Institutional Source

Beutler Lab

Gene Symbol

Aldh1l2

Ensembl Gene

ENSMUSG00000020256

Gene Name

aldehyde dehydrogenase 1 family, member L2

Synonyms

MMRRC Submission

043052-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5491 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

83487450-83534140 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 83522785 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 2 (D2E)

Ref Sequence

ENSEMBL: ENSMUSP00000117076 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020497] [ENSMUST00000146640]

AlphaFold

Q8K009

Predicted Effect

probably benign
Transcript: ENSMUST00000020497
AA Change: D115E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000020497
Gene: ENSMUSG00000020256
AA Change: D115E

Domain	Start	End	E-Value	Type
Pfam:Formyl_trans_N	23	202	5e-46	PFAM
Pfam:Formyl_trans_C	226	330	1.3e-16	PFAM
Pfam:PP-binding	346	412	9.6e-7	PFAM
Pfam:Aldedh	451	919	3.4e-174	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000138858

Predicted Effect

probably benign
Transcript: ENSMUST00000146640
AA Change: D2E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000117076
Gene: ENSMUSG00000020256
AA Change: D2E

Domain	Start	End	E-Value	Type
Pfam:Formyl_trans_N	1	89	2.8e-30	PFAM
Pfam:Formyl_trans_C	113	217	1.1e-16	PFAM
Pfam:PP-binding	233	299	1.5e-8	PFAM
Pfam:Aldedh	338	806	8.5e-175	PFAM

Coding Region Coverage

1x: 98.2%
3x: 97.2%
10x: 95.0%
20x: 89.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of both the aldehyde dehydrogenase superfamily and the formyl transferase superfamily. This member is the mitochondrial form of 10-formyltetrahydrofolate dehydrogenase (FDH), which converts 10-formyltetrahydrofolate to tetrahydrofolate and CO2 in an NADP(+)-dependent reaction, and plays an essential role in the distribution of one-carbon groups between the cytosolic and mitochondrial compartments of the cell. Alternatively spliced transcript variants have been found for this gene.[provided by RefSeq, Oct 2010]

Allele List at MGI

Other mutations in this stock

Total: 30 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1810041L15Rik	C	A	15: 84,406,510	V199L	probably benign	Het
A1cf	G	T	19: 31,918,062	A182S	possibly damaging	Het
Bach2	G	T	4: 32,562,681	D383Y	probably damaging	Het
Cd248	T	C	19: 5,070,209	L695P	probably damaging	Het
Cela1	T	A	15: 100,682,980	N132Y	probably damaging	Het
Cisd2	A	T	3: 135,408,840	D123E	probably damaging	Het
Col6a6	T	A	9: 105,738,236	D1571V	probably damaging	Het
Fam71e2	T	C	7: 4,757,926	I596V	probably benign	Het
Fbxo48	C	T	11: 16,954,280	T144M	probably damaging	Het
Fbxo7	C	A	10: 86,048,026	P497Q	probably damaging	Het
Gm12695	T	A	4: 96,769,668	H88L	possibly damaging	Het
Gm8994	C	G	6: 136,329,557	R339G	probably damaging	Het
Gpat4	A	G	8: 23,180,664	I133T	probably benign	Het
Hmcn1	C	T	1: 150,609,825		probably null	Het
Ncaph	T	C	2: 127,123,675	T252A	probably benign	Het
Nebl	G	T	2: 17,434,972	Y163*	probably null	Het
Neurod4	C	T	10: 130,271,067	V113I	possibly damaging	Het
Olfr1305	T	A	2: 111,873,562	I98F	probably benign	Het
Olfr411	A	T	11: 74,346,914	H103Q	probably benign	Het
Olfr71	A	G	4: 43,705,990	S193P	probably damaging	Het
Pbxip1	T	A	3: 89,443,159	M37K	probably benign	Het
Phactr2	T	C	10: 13,261,846	N184S	possibly damaging	Het
Phf20l1	C	T	15: 66,615,785	P480L	possibly damaging	Het
Psme4	T	C	11: 30,815,246	S538P	possibly damaging	Het
Rassf1	T	A	9: 107,561,415	M228K	possibly damaging	Het
Rpn2	A	G	2: 157,297,383	D231G	probably damaging	Het
She	A	T	3: 89,831,790	D96V	probably damaging	Het
Tmem260	T	A	14: 48,512,170		probably null	Het
Ttn	T	A	2: 76,732,358	I28751F	probably damaging	Het
Zfp60	T	G	7: 27,748,515		probably null	Het

Other mutations in Aldh1l2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01152:Aldh1l2	APN	10	83522886	nonsense	probably null
IGL01154:Aldh1l2	APN	10	83520373	missense	probably damaging	1.00
IGL01301:Aldh1l2	APN	10	83522846	missense	probably damaging	1.00
IGL01354:Aldh1l2	APN	10	83527376	missense	probably damaging	1.00
IGL01364:Aldh1l2	APN	10	83492667	missense	probably damaging	1.00
IGL01445:Aldh1l2	APN	10	83520262	splice site	probably benign
IGL02179:Aldh1l2	APN	10	83522837	missense	probably benign	0.10
IGL02283:Aldh1l2	APN	10	83495895	missense	probably benign	0.00
IGL02507:Aldh1l2	APN	10	83492584	nonsense	probably null
IGL02727:Aldh1l2	APN	10	83506605	missense	probably damaging	1.00
IGL03353:Aldh1l2	APN	10	83522913	missense	probably benign	0.17
Hunger_winter	UTSW	10	83508013	critical splice donor site	probably null
Spartan	UTSW	10	83512306	missense	possibly damaging	0.93
ANU18:Aldh1l2	UTSW	10	83522846	missense	probably damaging	1.00
IGL02984:Aldh1l2	UTSW	10	83527335	missense	probably damaging	1.00
R0267:Aldh1l2	UTSW	10	83522687	splice site	probably benign
R0302:Aldh1l2	UTSW	10	83520365	missense	probably damaging	1.00
R0349:Aldh1l2	UTSW	10	83490614	missense	probably damaging	1.00
R0468:Aldh1l2	UTSW	10	83518678	missense	probably benign	0.01
R0745:Aldh1l2	UTSW	10	83518630	splice site	probably null
R0788:Aldh1l2	UTSW	10	83516164	missense	probably damaging	1.00
R1117:Aldh1l2	UTSW	10	83508623	missense	probably benign	0.01
R1241:Aldh1l2	UTSW	10	83496025	missense	probably benign	0.00
R1420:Aldh1l2	UTSW	10	83495935	missense	probably damaging	1.00
R1490:Aldh1l2	UTSW	10	83520370	missense	probably damaging	1.00
R1704:Aldh1l2	UTSW	10	83508660	missense	probably benign	0.10
R1729:Aldh1l2	UTSW	10	83508082	nonsense	probably null
R1893:Aldh1l2	UTSW	10	83492536	missense	probably damaging	1.00
R1897:Aldh1l2	UTSW	10	83502525	missense	probably damaging	1.00
R2047:Aldh1l2	UTSW	10	83506743	missense	probably damaging	1.00
R2290:Aldh1l2	UTSW	10	83527313	missense	probably damaging	1.00
R3054:Aldh1l2	UTSW	10	83502472	missense	probably benign	0.14
R3055:Aldh1l2	UTSW	10	83502472	missense	probably benign	0.14
R4097:Aldh1l2	UTSW	10	83512364	missense	probably damaging	0.98
R4162:Aldh1l2	UTSW	10	83506654	missense	possibly damaging	0.50
R4295:Aldh1l2	UTSW	10	83495920	missense	possibly damaging	0.62
R4296:Aldh1l2	UTSW	10	83522777	missense	probably benign	0.34
R4388:Aldh1l2	UTSW	10	83513622	missense	probably damaging	1.00
R4809:Aldh1l2	UTSW	10	83506632	missense	probably damaging	1.00
R5052:Aldh1l2	UTSW	10	83508692	missense	possibly damaging	0.92
R5421:Aldh1l2	UTSW	10	83527407	missense	probably damaging	1.00
R5688:Aldh1l2	UTSW	10	83501925	missense	possibly damaging	0.93
R5726:Aldh1l2	UTSW	10	83512306	missense	possibly damaging	0.93
R5737:Aldh1l2	UTSW	10	83520325	missense	probably damaging	1.00
R5752:Aldh1l2	UTSW	10	83520380	missense	probably damaging	1.00
R6113:Aldh1l2	UTSW	10	83508134	nonsense	probably null
R6161:Aldh1l2	UTSW	10	83520338	missense	probably benign	0.00
R6166:Aldh1l2	UTSW	10	83493424	splice site	probably null
R6189:Aldh1l2	UTSW	10	83508013	critical splice donor site	probably null
R7357:Aldh1l2	UTSW	10	83514544	missense	possibly damaging	0.89
R7394:Aldh1l2	UTSW	10	83502457	missense	probably damaging	1.00
R7469:Aldh1l2	UTSW	10	83508105	missense	probably damaging	1.00
R7676:Aldh1l2	UTSW	10	83508111	missense	probably benign
R7848:Aldh1l2	UTSW	10	83499843	missense	probably benign	0.12
R7958:Aldh1l2	UTSW	10	83520338	missense	probably benign	0.00
R8311:Aldh1l2	UTSW	10	83490615	missense	probably damaging	1.00
R8477:Aldh1l2	UTSW	10	83501921	missense	probably damaging	1.00
R8730:Aldh1l2	UTSW	10	83506642	missense	possibly damaging	0.94
R8884:Aldh1l2	UTSW	10	83508677	missense	probably benign	0.02
R9117:Aldh1l2	UTSW	10	83506681	missense	probably benign	0.41
R9239:Aldh1l2	UTSW	10	83506632	missense	probably damaging	1.00
R9335:Aldh1l2	UTSW	10	83506646	missense	probably damaging	0.96
R9368:Aldh1l2	UTSW	10	83495952	nonsense	probably null
R9784:Aldh1l2	UTSW	10	83506750	critical splice acceptor site	probably null
Z1177:Aldh1l2	UTSW	10	83493480	missense	probably damaging	1.00
Z1177:Aldh1l2	UTSW	10	83534005	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- CACACCTCGTTTCTGTATCATGTAG -3'
(R):5'- GCCTGTAAAAGTTGTGTGAAATTGC -3'

Sequencing Primer
(F):5'- CCTCGTTTCTGTATCATGTAGAAGAG -3'
(R):5'- CCATGTGTTAATATGAGACCATGG -3'

Posted On

2016-10-05